Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pQFlag-USP7 WT puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46751 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 4 | |
|
pT3TS-nCas9n Resource Report Resource Website 100+ mentions |
RRID:Addgene_46757 | Cas9 | Synthetic | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ | Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 131 | |
|
pQHA-USP7 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46754 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C223S--catalytically inactive | 2026-08-15 01:15:35 | 2 |
|
pQFlag-USP11 WT puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46747 | USP11 | Ampicillin | PMID:20601937 | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 1 | |||
|
pQFlag-USP11 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46748 | USP11 | Homo sapiens | Ampicillin | PMID:20601937 | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C318S--catalytically inactive | 2026-08-15 01:15:35 | 1 | |
|
pMT mir-1-1 reporter cel-mir-240 Resource Report Resource Website |
RRID:Addgene_46742 | cel-mir-240 | Caenorhabditis elegans | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 0 | ||
|
pCMV4Neo-murine IL-17RASEFIR-HA Resource Report Resource Website |
RRID:Addgene_46863 | IL-17RA-delta-SEFIR | Mus musculus | Ampicillin | PMID:17456598 | Backbone Size:5750; Vector Backbone:pCMV4-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of SEFIR domain (AA 394-485) | 2026-08-15 01:15:36 | 0 | |
|
pMT mir-1-1 reporter cel-mir-50 Resource Report Resource Website |
RRID:Addgene_46740 | cel-mir-50 | Caenorhabditis elegans | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 0 | ||
|
pCMV4-Flag-mIL-17RA/CFP.Hygro Resource Report Resource Website |
RRID:Addgene_46861 | IL-17RA-CFP | Mus musculus | Ampicillin | PMID:17456598 | Backbone Size:6473; Vector Backbone:pCMV4-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | ||
|
pBABE-Puro-KRas*G12V Resource Report Resource Website 10+ mentions |
RRID:Addgene_46746 | KRAS*G12V | Homo sapiens | Ampicillin | PMID:23246410 | Backbone Size:5169; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | carries the oncogenic G12V mutation and cDNA is encoded by a chimeric mixture of HRAS and KRAS codons that encode KRas protein | 2026-08-15 01:15:35 | 14 | |
|
pGL3-24p3/LCN2-282kB mut-LUC Resource Report Resource Website |
RRID:Addgene_46867 | 24p3/lipocalin 2 proximal promoter | Mus musculus | Ampicillin | PMID:17456598 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | NF- kB site is mutated (see comments) | 2026-08-15 01:15:36 | 0 | |
|
pMT mir-1-1 reporter hsa-mir-128-1 Resource Report Resource Website |
RRID:Addgene_46743 | hsa-mir-128-1 | Homo sapiens | Ampicillin | PMID:23415231 | Backbone Marker:Bartel lab; Backbone Size:5179; Vector Backbone:pMT-DEST48 mir-1-1 reporter; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 0 | ||
|
pGL3-24p3/LCN2-282-LUC Resource Report Resource Website |
RRID:Addgene_46865 | 24p3/lipocalin 2 proximal promoter | Mus musculus | Ampicillin | PMID:17456598 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | ||
|
pMX-Brn4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47028 | Brn4 | Mus musculus | Ampicillin | PMID:22445517 | Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | The insert includes 40 bp of the TOPO vector in the 5 end | 2026-08-15 01:15:37 | 1 | |
|
pCDH-puro-Bcl2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46971 | Bcl2 | Homo sapiens | Ampicillin | PMID:23403638 | Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro. | Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 10 | |
|
pMusheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_47023 | Mu L1+L2 | Mus musculus | Ampicillin | PMID:22985477 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 1 | ||
|
pICE-EGFP-FLAG-Ku70siR-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46961 | human Ku70 | Homo sapiens | Ampicillin | PMID:23897892 | Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 1 | ||
|
pICH86966::AtU6p::sgRNA_PDS Resource Report Resource Website 10+ mentions |
RRID:Addgene_46966 | AtU6p::sgRNA_PDS | Synthetic | Kanamycin | PMID:23929340 | gRNA target sequence GCCGTTAATTTGAGAGTCCA | Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:37 | 25 | |
|
pICE-HA-NLS-I-PpoI Resource Report Resource Website 1+ mentions |
RRID:Addgene_46963 | NLS-I-PpoI | Physarum polycephalum | Ampicillin | PMID:23897892 | Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 3 | ||
|
pEGFP-C1-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_46956 | FLAG tag | Synthetic | Kanamycin | PMID:23897892 | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:37 | 9 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.