Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ERK2-MEK1 Fusion
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9799732
Comments: rat ERK2 fused to human MEK1 with a linker in between
Proper citation: RRID:Addgene_39194 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Comments: Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.
Proper citation: RRID:Addgene_39191 Copy
Species: Homo sapiens
Genetic Insert: PTPN5
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2BIJ/
Proper citation: RRID:Addgene_39166 Copy
Species: Homo sapiens
Genetic Insert: sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/1Z6Z/
Proper citation: RRID:Addgene_39161 Copy
Species: Homo sapiens
Genetic Insert: RGS14
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2JNU/
Proper citation: RRID:Addgene_39139 Copy
Species: Homo sapiens
Genetic Insert: RGS10
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2I59/
Proper citation: RRID:Addgene_39138 Copy
Species: Homo sapiens
Genetic Insert: PAK4
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pGEX-6P-2-Nde-Xho; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2Q0N/
Proper citation: RRID:Addgene_39137 Copy
Species: Homo sapiens
Genetic Insert: FDPS
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:p11; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2QIS/
Proper citation: RRID:Addgene_39131 Copy
Species: Homo sapiens
Genetic Insert: AKR7A2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2BP1/
Proper citation: RRID:Addgene_39130 Copy
Species: Homo sapiens
Genetic Insert: RGS16
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2BT2/
Proper citation: RRID:Addgene_39140 Copy
Genetic Insert: RAJ11 system (no transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39245 Copy
Vector Backbone Description: Backbone Marker:Registry of standard biological parts; Backbone Size:4042; Vector Backbone:pSB1AK3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Comments: This plasmid is used for inserting a 5'UTR in front of the GFP CDS using the NheI and EcoRi sites
Proper citation: RRID:Addgene_39240 Copy
Species: Homo sapiens
Genetic Insert: scFv-Fc-fusion specific for Notch2 (clone B9)
Vector Backbone Description: Backbone Marker:McCafferty lab unpublished; Vector Backbone:pBIOCAM5-3F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22842086
Comments: Binds to both mouse mNRR2 and human hNRR2. but neither NRR1.
Proper citation: RRID:Addgene_39348 Copy
Species: Homo sapiens
Genetic Insert: ERK1
Vector Backbone Description: Vector Backbone:NpT7-5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8444886
Proper citation: RRID:Addgene_39229 Copy
Species: Homo sapiens
Genetic Insert: scFv-Fc-fusion specific for Notch1 (clone B9)
Vector Backbone Description: Backbone Marker:McCafferty lab unpublished; Vector Backbone:pBIOCAM5-3F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22842086
Comments: Binds to both mouse mNRR1 and human hNRR1 but not NRR2.
Proper citation: RRID:Addgene_39344 Copy
Species: Homo sapiens
Genetic Insert: scFv specific for Jagged (clone D5)
Vector Backbone Description: Vector Backbone:pBIOCAM5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18047641
Proper citation: RRID:Addgene_39345 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Proper citation: RRID:Addgene_39296 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: CFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the CFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of CFP.
Proper citation: RRID:Addgene_46180 Copy
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46336 Copy
Species: Homo sapiens
Genetic Insert: Seh1
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46331 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
