Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,177 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA-Dazl-myc
 
Resource Report
Resource Website 		RRID:Addgene_21623 Dazl Rattus norvegicus Ampicillin Day 25 cDNA TD197b/TD198. Dazl sequence was determined and designed based on coding sequence available for rat genome in 2003. There may be a few discrepancies with the currently available sequence, most notably a C-terminal truncation and point mutation causing P196S. Backbone Marker:Invitrogen; Backbone Size:4911; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:03 0
pLLU2G-Dazl2
 
Resource Report
Resource Website 		RRID:Addgene_21622 Dazl shRNA-2 Rattus norvegicus Ampicillin Dazl shRNA sequence is - 5'-TTTGTTGATCCAGGAGCTGACCTTCAAGAGAGGTCAGCTCCTGGATCAACTTTT Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:12:04 0
pCEP4-HA-MEKK1-1-1493
 
Resource Report
Resource Website 		RRID:Addgene_21632 mitogen-activated protein kinase kinase kinase 1 Rattus norvegicus Ampicillin PMID:7624324 full length MEKK1 Backbone Marker:Invitrogen; Backbone Size:10400; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:04 0
myc-mTOR (1750-2549 aa)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21747 mTOR (1750-2549) Rattus norvegicus Ampicillin PMID:12718876 Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin amino acids 1750-2549 2026-08-15 01:12:05 3
myc-mTOR (1-1482 aa)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21745 mTOR (1-1482) Rattus norvegicus Ampicillin PMID:12718876 Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin amino acids 1-1482 2026-08-15 01:12:05 3
pBiFC-bJunVN173
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22012 bJunVN173 Rattus norvegicus Ampicillin PMID:16454041 Backbone Marker:Sigma; Backbone Size:4646; Vector Backbone:pFLAG-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin c-Jun(257-338)-Venus(1-172) 2026-08-15 01:12:07 13
pBiFC-bFosVC155
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22013 bFosVC155 Rattus norvegicus Ampicillin PMID:16454041 Backbone Marker:Clontech; Backbone Size:3759; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:12:07 17
pBiFC-bFOSDelataZipVC155
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22014 bFosDelataZIPVC155 Rattus norvegicus Ampicillin PMID:16454041 Backbone Marker:Clontech; Backbone Size:3756; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deletion of residues 179-193 in bFos(118-211) 2026-08-15 01:12:07 5
MT3
 
Resource Report
Resource Website 		RRID:Addgene_223331 3HA-EGFP-miniTurboID-OMP25 Rattus norvegicus Kanamycin PMID:38261530 Backbone Size:9000; Vector Backbone:s1300-3XFLAG; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:31:28 0
MT4
 
Resource Report
Resource Website 		RRID:Addgene_223332 3HA-miniTurboID-EGFP-OMP25 Rattus norvegicus Kanamycin PMID:38261530 Backbone Size:9000; Vector Backbone:s1300-EGFP; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:31:27 0
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
 
Resource Report
Resource Website 		RRID:Addgene_202555 CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) Rattus norvegicus Ampicillin PMID:37226896 Backbone Marker:Dr Konstantin Kogan; Backbone Size:14900; Vector Backbone:pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:31:29 0
pEGFP-Sec22b-P33-shR
 
Resource Report
Resource Website 		RRID:Addgene_208359 Sec22b Rattus norvegicus Kanamycin PMID:37794132 Original plasmid was generated in the laboratory of Dr. Thierry Galli, INSERM Paris (Ref: Petkovic, M., Jemaiel, A., Daste, F. et al. Nat Cell Biol 16, 434–444 (2014). https://doi.org/10.1038/ncb2937). It was cloned into a PvuI site in the pEGFP-Sec22b construct. The plasmid here was generated by site directed mutagenesis using the pEGFP-Sec22b-P33 construct as a template. Backbone Marker:Clonetech; Backbone Size:3930; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin four silent mutations (shRNA resistance), 33 aa proline tract 2026-08-15 01:29:26 0
pSAD-5PSD95-EGFP-SynPhRFP
 
Resource Report
Resource Website 		RRID:Addgene_217979 5PSD95-EGFP Rattus norvegicus Ampicillin PMID:38096019 Vector Backbone:pSAD; Vector Types:G-Deleted Rabies; Bacterial Resistance:Ampicillin 2026-08-15 01:29:28 0
CamKII-LGI1-pHmScarlet
 
Resource Report
Resource Website 		RRID:Addgene_185538 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:39 0
CamKII-LGI1-pHluorin
 
Resource Report
Resource Website 		RRID:Addgene_185537 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:39 0
CamKII-LGI1-T380A-pHluorin
 
Resource Report
Resource Website 		RRID:Addgene_185543 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin changed threonine 380 for alanine 2026-08-15 01:29:39 0
CamKII-LGI1-R474Q-pHluorin
 
Resource Report
Resource Website 		RRID:Addgene_185542 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin changed arginine 474 for glutamine 2026-08-15 01:29:39 0
CamKII-LGI1-S473L-pHluorin
 
Resource Report
Resource Website 		RRID:Addgene_185540 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin changed serine 473 for leucine 2026-08-15 01:29:39 0
CamKII-LGI1-C200R-pHluorin
 
Resource Report
Resource Website 		RRID:Addgene_185545 LGI1 Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CamKII; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin changed cysteine 383 for arginine 2026-08-15 01:29:39 0
CMV-IgK-pHluorin-TM-mRuby
 
Resource Report
Resource Website 		RRID:Addgene_185546 IgK-pHluorin-TM-mRuby Rattus norvegicus Ampicillin PMID:38700985 Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint. Vector Backbone:CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch