Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 57 showing 1121 ~ 1140 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_58894

http://www.addgene.org/58894

Species: Homo sapiens
Genetic Insert: TEM4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22911862

Proper citation: RRID:Addgene_58894 Copy   


  • RRID:Addgene_58891

    This resource has 1+ mentions.

http://www.addgene.org/58891

Species: Danio rerio
Genetic Insert: zebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 7.4 kb
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONR P4-P1R; Vector Types:Gateway 5' entry clone; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_58891 Copy   


  • RRID:Addgene_58893

    This resource has 1+ mentions.

http://www.addgene.org/58893

Species: Homo sapiens
Genetic Insert: TEM4
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22911862
Comments: Please note that the Addgene verified sequence identified a L722F mutation in TEM4. It is unknown whether this mutation affects protein function.

Proper citation: RRID:Addgene_58893 Copy   


  • RRID:Addgene_58982

http://www.addgene.org/58982

Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC

Proper citation: RRID:Addgene_58982 Copy   


http://www.addgene.org/59032

Species: Homo sapiens
Genetic Insert: CAMSAP2 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59032 Copy   


http://www.addgene.org/59031

Species: Homo sapiens
Genetic Insert: CAMSAP1 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59031 Copy   


  • RRID:Addgene_58981

http://www.addgene.org/58981

Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG

Proper citation: RRID:Addgene_58981 Copy   


http://www.addgene.org/59048

Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59048 Copy   


http://www.addgene.org/59053

Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919

Proper citation: RRID:Addgene_59053 Copy   


  • RRID:Addgene_59149

    This resource has 1+ mentions.

http://www.addgene.org/59149

Species: Homo sapiens
Genetic Insert: p38 Kinase Translocation Reporter
Vector Backbone Description: Vector Backbone:pENTR; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24949979

Proper citation: RRID:Addgene_59149 Copy   


  • RRID:Addgene_59146

http://www.addgene.org/59146

Species: Homo sapiens
Genetic Insert: PKA Kinase Translocation Reporter
Vector Backbone Description: Vector Backbone:pENTR; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24949979

Proper citation: RRID:Addgene_59146 Copy   


  • RRID:Addgene_59177

    This resource has 1+ mentions.

http://www.addgene.org/59177

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:6200; Vector Backbone:pPZP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25879861

Proper citation: RRID:Addgene_59177 Copy   


  • RRID:Addgene_59178

    This resource has 1+ mentions.

http://www.addgene.org/59178

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:6200; Vector Backbone:pPZP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25879861

Proper citation: RRID:Addgene_59178 Copy   


  • RRID:Addgene_59184

    This resource has 1+ mentions.

http://www.addgene.org/59184

Species: Glycine Max
Genetic Insert: Glycine Max codon optimized Cas9
Vector Backbone Description: Backbone Marker:Douglas Baker UC Davis; Backbone Size:10213; Vector Backbone:pMDC123; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479970

Proper citation: RRID:Addgene_59184 Copy   


  • RRID:Addgene_59187

http://www.addgene.org/59187

Species: Glycine Max
Genetic Insert: Glycine Max codon optimized Cas9
Vector Backbone Description: Backbone Marker:Mark D Curtis; Backbone Size:10213; Vector Backbone:pMDC123; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479970

Proper citation: RRID:Addgene_59187 Copy   


  • RRID:Addgene_59391

http://www.addgene.org/59391

Species: Homo sapiens
Genetic Insert: RBPMS
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5365; Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24860013

Proper citation: RRID:Addgene_59391 Copy   


http://www.addgene.org/59357

Species: Homo sapiens
Genetic Insert: Transforming Acidic Coiled Coil protein 3
Vector Backbone Description: Backbone Marker:Stephen J Royle; Backbone Size:5438; Vector Backbone:pBrain; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21297582

Proper citation: RRID:Addgene_59357 Copy   


  • RRID:Addgene_59356

    This resource has 1+ mentions.

http://www.addgene.org/59356

Species: Homo sapiens
Genetic Insert: Transforming Acidic Coiled Coil protein 3
Vector Backbone Description: Backbone Marker:Stephen J Royle; Backbone Size:5438; Vector Backbone:pBrain; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21297582

Proper citation: RRID:Addgene_59356 Copy   


  • RRID:Addgene_59353

    This resource has 1+ mentions.

http://www.addgene.org/59353

Species: Homo sapiens
Genetic Insert: Clathrin Light Chain A
Vector Backbone Description: Backbone Size:4676; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23532825

Proper citation: RRID:Addgene_59353 Copy   


  • RRID:Addgene_59352

    This resource has 10+ mentions.

http://www.addgene.org/59352

Vector Backbone Description: Backbone Size:5132; Vector Backbone:pMito; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23532825

Proper citation: RRID:Addgene_59352 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X