Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Clathrin light chain B
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193573 Copy
Species: Homo sapiens
Genetic Insert: ARRB2-CTEV-2xHA
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36671883
Proper citation: RRID:Addgene_194382 Copy
Species: Synthetic
Genetic Insert: eHcKCR1 3.0-oScarlet-Kv2.1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5623; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36669484
Proper citation: RRID:Addgene_195198 Copy
Species: Rattus norvegicus
Genetic Insert: PH domain from PLC delta1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193570 Copy
Species: Mus musculus
Genetic Insert: Fgf15
Vector Backbone Description: Backbone Marker:N/A; Vector Backbone:Derived from scAAV-TTR-CRE; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36719070
Comments: scAAV-TTR-FGF15 was produced from the complementary strand AAVS
construct, csAAV-TTR-CRE plasmid ( a kind gift of Holger Willenbring).
Proper citation: RRID:Addgene_190594 Copy
Species: Streptococcus thermophilus
Genetic Insert: FLAG-NLS-Csm1; FLAG-NLS-Csm2; FLAG-NLS-Csm3(RNase mut); FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA; GFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36690762
Proper citation: RRID:Addgene_195241 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG
Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG
Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC
Proper citation: RRID:Addgene_195857 Copy
Species: Danio rerio
Genetic Insert: ubi:mCerulean
Vector Backbone Description: Vector Backbone:pDestTol2pA2; Vector Types:Other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36975217
Comments: Please visit https://doi.org/10.1101/2022.12.13.520107 for bioRxiv preprint.
Proper citation: RRID:Addgene_195978 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - CTGTCAGATCCATAGCGAATC
Antisense PCR primer (5'-->3') - CTCTGACCTGACTGAACAATAC
Sequencing primer (5'-->3') - GCTATCCGGCAGCTTCTTAAT
Proper citation: RRID:Addgene_195856 Copy
Genetic Insert: mTurquoise2-mScarlet-I
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193558 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195859 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TCCTTCTCTGGTGTTGTTTG
Antisense PCR primer (5'-->3') - TTGGCTGCTCTGACTTTG
Sequencing primer (5'-->3') - CGGTTGACCTTGAGAGAGTTAAT
Proper citation: RRID:Addgene_195858 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193553 Copy
Genetic Insert: ShadowY
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193555 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pBluescript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36459969
Comments: This plasmid was generated by replacing the luciferace sequence of the PG13-Luc reporter plasmid (Addgene 16442; DOI: 10.1016/0092-8674(93)90500-p), which contains 13 copies of a p53-binding site followed by the polyoma promoter, with the mCherry sequence.
Proper citation: RRID:Addgene_195291 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:H. Oguro, unpublished; Vector Backbone:PB-EF1a-PuroR-EGFP; Vector Types:Mammalian Expression, piggyBac transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36459969
Comments: This plasmid was generated by inserting the PG13-mCherry sequence (Addgene 195291) into the PB-EF1a-PuroR-EGFP plasmid (H. Oguro, unpublished), and contains the piggyBac 3'-inverted terminal repeat (PB 3'ITR), 5'-HS4 chicken b-globin (cHS4) insulator, PG13-mCherry reporter, woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), bovine growth hormone polyadenylation signal (bGHpA), EF1a promoter, puromycin registrant gene, P2A peptide, EGFP, bGHpA, cHS4 insulator, and PB 5'ITR, in this order.
Proper citation: RRID:Addgene_195292 Copy
Species: Synthetic
Genetic Insert: NLS-mCherry
Vector Backbone Description: Vector Backbone:PLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36450983
Proper citation: RRID:Addgene_195332 Copy
Vector Backbone Description: Vector Backbone:pDestTol2pA2; Vector Types:Other; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:36975217
Comments: Please visit https://doi.org/10.1101/2022.12.13.520107 for bioRxiv preprint.
Proper citation: RRID:Addgene_195989 Copy
Species: Rattus norvegicus
Genetic Insert: PH domain from PLC delta1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193569 Copy
Species: Homo sapiens
Genetic Insert: Clathrin light chain B
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36759616
Comments: Please visit https://doi.org/10.1101/2022.03.21.485138 for bioRxiv preprint.
Proper citation: RRID:Addgene_193564 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
