Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,857 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEGFP TEM4 DEL NTERM
 
Resource Report
Resource Website 		RRID:Addgene_58894 TEM4 Homo sapiens Kanamycin PMID:22911862 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Deleted N Terminus up to aa 1002 2026-08-15 01:17:19 0
p5'Entry-lck-7.4kb
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58891 zebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 7.4 kb Danio rerio Kanamycin Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONR P4-P1R; Vector Types:Gateway 5' entry clone; Bacterial Resistance:Kanamycin mutated single nucleotide (T-->C, 1874th nucleotide of insert) to create novel SfiI site 2026-08-15 01:17:19 2
pEGFP TEM4 FL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58893 TEM4 Homo sapiens Kanamycin PMID:22911862 Please note that the Addgene verified sequence identified a L722F mutation in TEM4. It is unknown whether this mutation affects protein function. Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin L722F 2026-08-15 01:17:19 2
pCCM937
 
Resource Report
Resource Website 		RRID:Addgene_58982 avr-15 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GTTTGCAATATAAGTCACCC Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pET-28a+GFP-CAMSAP2 CKK
 
Resource Report
Resource Website 		RRID:Addgene_59032 CAMSAP2 CKK domain Homo sapiens Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pET-28a+GFP-CAMSAP1 CKK
 
Resource Report
Resource Website 		RRID:Addgene_59031 CAMSAP1 CKK domain Homo sapiens Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pCCM936
 
Resource Report
Resource Website 		RRID:Addgene_58981 avr-14 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GATTGGAGAGTTAGACCACG Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pENTR-GFP-Patronin CC+CKK
 
Resource Report
Resource Website 		RRID:Addgene_59048 Patronin Drosophila melanogaster Kanamycin PMID:24706919 Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pET-28a-GFP-Patronin CC 868–1457
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59053 Patronin Drosophila melanogaster Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 1
pENTR-p38KTRmCerulean3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59149 p38 Kinase Translocation Reporter Homo sapiens Kanamycin PMID:24949979 Vector Backbone:pENTR; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 2
pENTR-PKAKTRClover
 
Resource Report
Resource Website 		RRID:Addgene_59146 PKA Kinase Translocation Reporter Homo sapiens Kanamycin PMID:24949979 Vector Backbone:pENTR; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 0
p201B Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59177 Cas9 Synthetic Kanamycin PMID:25879861 Backbone Size:6200; Vector Backbone:pPZP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 1
p201G Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59178 Cas9 Synthetic Kanamycin PMID:25879861 Backbone Size:6200; Vector Backbone:pPZP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 3
Cas9 MDC123
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59184 Glycine Max codon optimized Cas9 Glycine Max Kanamycin PMID:26479970 Backbone Marker:Douglas Baker UC Davis; Backbone Size:10213; Vector Backbone:pMDC123; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 6
G10 Cas9 MDC123
 
Resource Report
Resource Website 		RRID:Addgene_59187 Glycine Max codon optimized Cas9 Glycine Max Kanamycin PMID:26479970 Backbone Marker:Mark D Curtis; Backbone Size:10213; Vector Backbone:pMDC123; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:21 0
pet28a_RBPMS_FL
 
Resource Report
Resource Website 		RRID:Addgene_59391 RBPMS Homo sapiens Kanamycin PMID:24860013 Backbone Marker:Novagen; Backbone Size:5365; Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:23 0
pBrain-GFP-TACC3KDP(S558A)-shTACC3
 
Resource Report
Resource Website 		RRID:Addgene_59357 Transforming Acidic Coiled Coil protein 3 Homo sapiens Kanamycin PMID:21297582 Backbone Marker:Stephen J Royle; Backbone Size:5438; Vector Backbone:pBrain; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin Silent mutations in amino acids 30-33 to confer siRNA resistance. Serine 558 changed to Alanine. 2026-08-15 01:17:22 0
pBrain-GFP-TACC3KDP-shTACC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59356 Transforming Acidic Coiled Coil protein 3 Homo sapiens Kanamycin PMID:21297582 Backbone Marker:Stephen J Royle; Backbone Size:5438; Vector Backbone:pBrain; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin Silent mutations in amino acids 30-33 to confer siRNA resistance. 2026-08-15 01:17:22 4
GFP-FKBP-LCa
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59353 Clathrin Light Chain A Homo sapiens Kanamycin PMID:23532825 Backbone Size:4676; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:22 2
pMito-mCherry-FRB
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_59352 Kanamycin PMID:23532825 Backbone Size:5132; Vector Backbone:pMito; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:22 13

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch