Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 58 showing 1141 ~ 1160 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46510

    This resource has 1+ mentions.

http://www.addgene.org/46510

Species: Homo sapiens
Genetic Insert: Src
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.5 kDa

Proper citation: RRID:Addgene_46510 Copy   


  • RRID:Addgene_46479

    This resource has 1+ mentions.

http://www.addgene.org/46479

Species: Homo sapiens
Genetic Insert: SH2-B
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa

Proper citation: RRID:Addgene_46479 Copy   


http://www.addgene.org/46617

Species: Homo sapiens
Genetic Insert: miR-375 Decoy
Vector Backbone Description: Backbone Size:8233; Vector Backbone:AB.pCCLsin.PPT.U6.hPGK.GFP.wpre; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22751203
Comments: Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.

Proper citation: RRID:Addgene_46617 Copy   


http://www.addgene.org/46676

Species: Homo sapiens
Genetic Insert: hsa-mir-133a-1
Vector Backbone Description: Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23415231

Proper citation: RRID:Addgene_46676 Copy   


  • RRID:Addgene_46858

    This resource has 1+ mentions.

http://www.addgene.org/46858

Vector Backbone Description: Backbone Marker:unknown; Backbone Size:4980; Vector Backbone:pBR322; Vector Types:sequencing vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21410291

Proper citation: RRID:Addgene_46858 Copy   


  • RRID:Addgene_46848

    This resource has 1+ mentions.

http://www.addgene.org/46848

Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2960; Vector Backbone:pBluescript SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21445009

Proper citation: RRID:Addgene_46848 Copy   


http://www.addgene.org/46835

Genetic Insert: Coral Green Fluorescent Protein (cGFP)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23073843

Proper citation: RRID:Addgene_46835 Copy   


  • RRID:Addgene_46793

    This resource has 10+ mentions.

http://www.addgene.org/46793

Species: Homo sapiens
Genetic Insert: PGK
Vector Backbone Description: Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038801

Proper citation: RRID:Addgene_46793 Copy   


  • RRID:Addgene_46824

    This resource has 10+ mentions.

http://www.addgene.org/46824

Species: Mus musculus
Genetic Insert: Bmal1
Vector Backbone Description: Backbone Marker:Addgene plasmid 12254; Vector Backbone:pWPI; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16167846
Comments: The insert consists of 1 kb of mouse Bmal1 upstream region and 53 nucleotides of exon 1, fused in-frame to the luciferase coding region, and followed by 1 kb of Bmal1 3′UTR.

Proper citation: RRID:Addgene_46824 Copy   


  • RRID:Addgene_46829

    This resource has 1+ mentions.

http://www.addgene.org/46829

Species: Homo sapiens
Genetic Insert: GNA13
Vector Backbone Description: Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000).

Proper citation: RRID:Addgene_46829 Copy   


  • RRID:Addgene_46786

    This resource has 1+ mentions.

http://www.addgene.org/46786

Species: Homo sapiens
Genetic Insert: RAB11A S25N
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)

Proper citation: RRID:Addgene_46786 Copy   


  • RRID:Addgene_46783

    This resource has 1+ mentions.

http://www.addgene.org/46783

Species: Homo sapiens
Genetic Insert: RAB8A
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.

Proper citation: RRID:Addgene_46783 Copy   


  • RRID:Addgene_46814

    This resource has 1+ mentions.

http://www.addgene.org/46814

Vector Backbone Description: Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108

Proper citation: RRID:Addgene_46814 Copy   


  • RRID:Addgene_46819

    This resource has 1+ mentions.

http://www.addgene.org/46819

Vector Backbone Description: Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24161108

Proper citation: RRID:Addgene_46819 Copy   


  • RRID:Addgene_46776

    This resource has 1+ mentions.

http://www.addgene.org/46776

Species: Homo sapiens
Genetic Insert: Rab1a
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information.

Proper citation: RRID:Addgene_46776 Copy   


  • RRID:Addgene_46777

    This resource has 1+ mentions.

http://www.addgene.org/46777

Species: Homo sapiens
Genetic Insert: Rab1a S25N mutant
Vector Backbone Description: Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959776
Comments: cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)

Proper citation: RRID:Addgene_46777 Copy   


  • RRID:Addgene_46770

    This resource has 1+ mentions.

http://www.addgene.org/46770

Species: Rattus norvegicus
Genetic Insert: GAL4(1-147)-CREB-S133A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7958915

Proper citation: RRID:Addgene_46770 Copy   


  • RRID:Addgene_46769

    This resource has 1+ mentions.

http://www.addgene.org/46769

Species: Rattus norvegicus
Genetic Insert: GAL4(1-147)-CREB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7958915

Proper citation: RRID:Addgene_46769 Copy   


  • RRID:Addgene_46763

    This resource has 1+ mentions.

http://www.addgene.org/46763

Vector Backbone Description: Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23799955
Comments: This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. This plasmid has been found exist in our stock as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

Proper citation: RRID:Addgene_46763 Copy   


  • RRID:Addgene_46764

    This resource has 1+ mentions.

http://www.addgene.org/46764

Vector Backbone Description: Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23799955
Comments: This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus.

Proper citation: RRID:Addgene_46764 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X