Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 58 showing 1141 ~ 1160 out of 1,737 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/174894

Species: E. coli
Genetic Insert: AnapRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37935196

Proper citation: RRID:Addgene_174894 Copy   


  • RRID:Addgene_207588

http://www.addgene.org/207588

Species: E. coli
Genetic Insert: GFP-TonBH20A
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207588 Copy   


  • RRID:Addgene_207589

http://www.addgene.org/207589

Species: E. coli
Genetic Insert: GFP-TolA deltaII
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207589 Copy   


  • RRID:Addgene_207585

http://www.addgene.org/207585

Species: E. coli
Genetic Insert: GFP-TolA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207585 Copy   


  • RRID:Addgene_207587

http://www.addgene.org/207587

Species: E. coli
Genetic Insert: GFP-TonB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207587 Copy   


  • RRID:Addgene_207598

http://www.addgene.org/207598

Species: E. coli
Genetic Insert: GFP-BBA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207598 Copy   


  • RRID:Addgene_207601

http://www.addgene.org/207601

Species: E. coli
Genetic Insert: GFP-ABA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207601 Copy   


  • RRID:Addgene_207602

http://www.addgene.org/207602

Species: E. coli
Genetic Insert: GFP-AABA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207602 Copy   


  • RRID:Addgene_207591

http://www.addgene.org/207591

Species: E. coli
Genetic Insert: GFP-AIA H22A
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207591 Copy   


  • RRID:Addgene_199118

http://www.addgene.org/199118

Species: E. coli
Genetic Insert: H6-SNAP-RapA
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pQE80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37406096

Proper citation: RRID:Addgene_199118 Copy   


http://www.addgene.org/205015

Species: E. coli
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35594503
Comments: Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG

Proper citation: RRID:Addgene_205015 Copy   


  • RRID:Addgene_182962

http://www.addgene.org/182962

Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182962 Copy   


  • RRID:Addgene_182959

http://www.addgene.org/182959

Species: E. coli
Genetic Insert: gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182959 Copy   


  • RRID:Addgene_212151

http://www.addgene.org/212151

Species: E. coli
Genetic Insert: xylitol dehydrogenase
Vector Backbone Description: Vector Backbone:pMB1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35842981
Comments: Producing aromatic amino acid from corn husk by using polyols as intermediates (DOI: 10.1016/j.biomaterials.2022.121661)

Proper citation: RRID:Addgene_212151 Copy   


  • RRID:Addgene_203881

http://www.addgene.org/203881

Species: E. coli
Genetic Insert: aminoglycoside O-phosphotransferase APH(3')-IIa
Vector Backbone Description: Backbone Size:4747; Vector Backbone:pHI1; Vector Types:Bacterial Expression, Yeast Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Kanamycin

Proper citation: RRID:Addgene_203881 Copy   


  • RRID:Addgene_207584

http://www.addgene.org/207584

Species: E. coli
Genetic Insert: TolQ-TolR-TEV-Strep_His
Vector Backbone Description: Vector Backbone:pT12; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207584 Copy   


  • RRID:Addgene_207599

http://www.addgene.org/207599

Species: E. coli
Genetic Insert: GFP-BAA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207599 Copy   


  • RRID:Addgene_207827

http://www.addgene.org/207827

Species: E. coli
Genetic Insert: PGUS
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38085818

Proper citation: RRID:Addgene_207827 Copy   


  • RRID:Addgene_208309

http://www.addgene.org/208309

Species: E. coli
Genetic Insert: TadA-RA4.4-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208309 Copy   


  • RRID:Addgene_208305

http://www.addgene.org/208305

Species: E. coli
Genetic Insert: TadA-RA4.0-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208305 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X