Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Pf113-bio Resource Report Resource Website 1+ mentions |
RRID:Addgene_47729 | Codon-optimised Pf113 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine209, Serine270, Threonine319, Serine362, Serine663, Threonine699, Serine781, Threonine878 and Threonine940 to Alanine residues | 2026-08-15 01:15:44 | 2 | |
|
CLAG3.2-bio Resource Report Resource Website |
RRID:Addgene_47797 | Codon-optimised CLAG3.2 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Threonine75, Threonine114, Threonine476, Threonine542, Threonine641, Serine941, Serine1013, Serine1062, Threonine1130 and Threonine1373 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
PTRAMP-bio Resource Report Resource Website |
RRID:Addgene_47793 | Codon-optimised PTRAMP | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine114, Serine151, Serine157, Serine172, Threonine197, Threonine204 and Serine255 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
RAP1-bio Resource Report Resource Website |
RRID:Addgene_47794 | Codon-optimised RAP1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine74, Threonine84, Serine92, Serine170, Threonine329, Serine357 and Threonine404 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
PF3D7_1431400-bio Resource Report Resource Website |
RRID:Addgene_47791 | Codon-optimised PF3D7_1431400 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine27, Serine31, Serine35, Threonine70, Serine102, Serine103, Serine300, Threonine309, Threonine313, Threonine387, Serine481, Serine497, Serine498, Serine502, Serine513, Serine551, Serine574, Threonine622, Threonine644, Serine732, Serine743, Serine785 and Serine962 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
EBL1-bio Resource Report Resource Website |
RRID:Addgene_47792 | Codon-optimised EBL1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine37, Serine53, Serine150, Serine255, Threonine313, Serine722, Serine845, Serine957, Serine1010, Serine1175, Serine1220, Serine1239, Serine1325, Threonine1346, Serine1352, Serine1606, Threonine1798, Serine1829, Serine2161, Serine2310, Serine2356, Serine2403, Threonine2426, Threonine2432, Serine2480, Serine2508, Threonine2518, Serine2560 and Threonine2573 to Alanine residues | 2026-08-15 01:15:45 | 0 | |
|
3xFLAG-dCas9/pCMV-7.1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_47948 | 3xFLAG-dCas9 | Ampicillin | PMID:23942116 | This plasmid can be used to isolate specific genomic regions of interest using a catalytically inactive Cas9 fused with a tag(s). Purify: locus-specific chromatin immunoprecipitation (enChIP) This system is compatible with gRNA_cloning_vector (www.addgene.org/41824) from the Church lab. Additional information and protocols can be found at: http://www.med.hirosaki-u.ac.jp/~bgb/iChIP_protocols/index_e.html | Backbone Marker:Sigma-Aldrich; Backbone Size:4636; Vector Backbone:pCMV-7.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | human codon-optimized, D10A + H840A (catalytically inactive) | 2026-08-15 01:15:46 | 12 | |
|
pMB66 Resource Report Resource Website |
RRID:Addgene_47946 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pCMV rat SAPAP1 Resource Report Resource Website |
RRID:Addgene_47940 | SAPAP1 | Rattus norvegicus | Ampicillin | PMID:9115257 | Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | ||
|
pMB62 Resource Report Resource Website |
RRID:Addgene_47944 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | |
|
pMB63 Resource Report Resource Website |
RRID:Addgene_47945 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pClneoMyc MOB1 T35A Resource Report Resource Website |
RRID:Addgene_47937 | MOB1A | Homo sapiens | Ampicillin | PMID:19919647 | Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T35A | 2026-08-15 01:15:47 | 0 | |
|
pClneoMyc human CIN85 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47935 | CIN85 | Homo sapiens | Ampicillin | PMID:16751601 | The CIN85 insert in this plasmid contains a D114G mutation when compared to GenBank accession number NP_114098.1. This mutation was not intentional and was present in the original CIN85 clone. | Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contains amino acids 2-665 of human CIN85; D114G | 2026-08-15 01:15:45 | 2 |
|
pClneoMyc MOB1 T12A Resource Report Resource Website |
RRID:Addgene_47936 | MOB1A | Homo sapiens | Ampicillin | PMID:19919647 | Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T12A | 2026-08-15 01:15:45 | 0 | |
|
pRK5-myc-Miro2 A13V Resource Report Resource Website |
RRID:Addgene_47896 | Miro2 A13V | Homo sapiens | Ampicillin | PMID:16630562 | Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A13V, constitutively active mutant | 2026-08-15 01:15:45 | 0 | |
|
pRK5-myc-Miro2 T18N Resource Report Resource Website 1+ mentions |
RRID:Addgene_47897 | Miro2 T18N | Homo sapiens | Ampicillin | PMID:16630562 | Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T18N, dominant negative mutant | 2026-08-15 01:15:45 | 1 | |
|
pT7goldRNA Resource Report Resource Website |
RRID:Addgene_47930 | golden gRNA | Danio rerio | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC | Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 0 | |
|
pRK5-myc-Miro1 E208K/E328K Resource Report Resource Website 1+ mentions |
RRID:Addgene_47894 | Miro1 E208K/E328K | Homo sapiens | Ampicillin | PMID:16630562 | Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E208K/E328K, abolishes calcium binding | 2026-08-15 01:15:45 | 3 | |
|
pIK86 Resource Report Resource Website |
RRID:Addgene_47933 | Cas9 | Synthetic | Ampicillin | PMID:23979578 | Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 0 | ||
|
pClneoFLAG human Dendrin Resource Report Resource Website |
RRID:Addgene_47934 | Dendrin-1 | Homo sapiens | Ampicillin | PMID:16751601 | Backbone Marker:Promega; Vector Backbone:pCI-neo (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contains amino acids 2-711 of human Dendrin | 2026-08-15 01:15:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
