Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33326 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The truncation was made by placing a stop codon at 460, but sequence was not actually removed.
The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33324 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33329 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33327 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34686 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34687 Copy
Species: Rattus norvegicus
Genetic Insert: βarrestin2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15699045
Proper citation: RRID:Addgene_35412 Copy
Species: Rattus norvegicus
Genetic Insert: Shank3
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Shank3 [N69/46R].
Proper citation: RRID:Addgene_197335 Copy
Species: Rattus norvegicus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182907 Copy
Species: Rattus norvegicus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182906 Copy
Species: Rattus norvegicus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182902 Copy
Species: Rattus norvegicus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182911 Copy
Species: Rattus norvegicus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182915 Copy
Species: Rattus norvegicus
Genetic Insert: anti-TH (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182898 Copy
Species: Rattus norvegicus
Genetic Insert: anti-PVALB (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182895 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Vector Backbone:Mammalian Conditional Gene Expression AAV Vector (Cre-On); Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36564546
Proper citation: RRID:Addgene_194642 Copy
Species: Rattus norvegicus
Genetic Insert: ND6-W82-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198860 Copy
Species: Rattus norvegicus
Genetic Insert: mCh-V5-NES-EGFP-Erbb2 NLS
Vector Backbone Description: Backbone Marker:Addgene #25752; Vector Backbone:pEN_TTmiRC2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37055441
Proper citation: RRID:Addgene_192317 Copy
Species: Rattus norvegicus
Genetic Insert: mCh-V5-NES-EGFP-Erbb2 NLS
Vector Backbone Description: Backbone Marker:Addgene #25736; Vector Backbone:pSLIK zeo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37055441
Proper citation: RRID:Addgene_192339 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed
Proper citation: RRID:Addgene_184504 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
