Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pT7mitfagRNA
 
Resource Report
Resource Website 		RRID:Addgene_47931 mitfa gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pT7ddx19gRNA
 
Resource Report
Resource Website 		RRID:Addgene_47932 ddx19 gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGCAACAGATTCGTGGGCCC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pRK5-myc-Miro2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47891 Miro2 Homo sapiens Ampicillin PMID:12482879 Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 9
pET22b-EC12-129/138
 
Resource Report
Resource Website 		RRID:Addgene_47926 E-Cadherin EC12 Mus musculus Ampicillin PMID:23923816 Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutations is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria. Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Mutations C9A, K129C, D138C 2026-08-15 01:15:45 0
pET22b-EC12WTC9A
 
Resource Report
Resource Website 		RRID:Addgene_47924 E-Cadherin EC12 Mus musculus Ampicillin PMID:23923816 Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutation is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria. Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin changed Cysteine 9 to Alanine 2026-08-15 01:15:45 0
pcDNA-T1ER
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47928 T1ER Synthetic Ampicillin PMID:23838183 Ratiometric calcium sensor targeted to ER with KDEL sequence. The CFP fragment of Addgene plasmid 36325 pcDNA-D1ER was replaced with the brighter fluorescent protein mTurquoise. Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin KDEL 2026-08-15 01:15:47 2
pCS2-nCas9n
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_47929 nls-zcas9-nls Synthetic Ampicillin PMID:23918387 Note from depositor: Although this plasmid produces smaller transcripts in addition to the expected one, the product mixture displays activity comparable to that from pT3TS-nCas9n. For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 103
pTALYM3-Telo1
 
Resource Report
Resource Website 		RRID:Addgene_47883 TALE-mClover Ampicillin PMID:24096363 Vector Backbone:pTALYM3; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pCAG-H2BtdiRFP-IP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47884 H2B-tdiRFP Ampicillin PMID:24096363 Vector Backbone:pCAG-ME-IP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 8
pRK5-myc-Miro1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47888 Miro1 Homo sapiens Ampicillin PMID:12482879 Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 13
pTALYM4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47875 Ampicillin PMID:24096363 Vector Backbone:pCAG-T7-TALEN (Sangamo); Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 1
pSimpleII-NmCas9-FLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47872 NmCas9 N meningitidis Ampicillin PMID:23940360 Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 1
pTALYM3B15
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47878 TALE-mClover Ampicillin PMID:24096363 Vector Backbone:pTALYM3; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 19
SP6-hCas9-Ce-mRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47911 hCas9 with C. elegans 5' and 3' UTRs Homo sapiens Ampicillin PMID:23979577 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 1
pTALYM4SpMi-01
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47879 TALE-mRuby2 Ampicillin PMID:24096363 Vector Backbone:pTALYM4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 2
pTALYM9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47876 Ampicillin PMID:24096363 Vector Backbone:pCAG-T7-TALEN (Sangamo); Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 1
pTALYM9B15
 
Resource Report
Resource Website 		RRID:Addgene_47877 TALE-Ty1 Ampicillin PMID:24096363 Vector Backbone:pTALYM9; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 0
pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47869 NmCas9 N meningitidis Ampicillin PMID:23940360 Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 1
pMXs-hLIN28A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47902 human LIN28A Homo sapiens Ampicillin PMID:23812749 pMXs is from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H. Backbone Marker:Dr.Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 4
pOTTC364 - pAAV CaMKIIa iRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47903 Infrared fluorescent protein Rhodopseudomonas palustris Ampicillin PMID:28380331 Backbone Marker:Karl Deisseroth; Vector Backbone:pAAV CaMKII hChR2-EYFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch