Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: ADE2
Vector Backbone Description: Vector Backbone:pJJ244; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid M3499 (ura3::ADE2 ) was made by cutting pJJ244 with StuI and EcoRV and replacing the 248 bp StuI–EcoRV fragment with a 3.6 kb BamHI blunted with Klenow) fragment containing ADE2 from plasmid M1144.
Proper citation: RRID:Addgene_51674 Copy
Genetic Insert: KanMX3
Vector Backbone Description: Vector Backbone:YDp-L; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12898713
Comments: Plasmid M3926 (leu2::KanMX3 ) was made by cutting YDp-L with EcoRV and inserting a 2.5 kb BglII–EcoRI (both ends blunted with Klenow)fragment containing KanMX3 from plasmid pFA6–KanMX3.
Proper citation: RRID:Addgene_51680 Copy
Species: Synthetic
Genetic Insert: SpyLigase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24639550
Comments: SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins.
pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/
pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/
SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth
Transform plasmid into BL21 DE3 RIPL for expression.
Proper citation: RRID:Addgene_51722 Copy
Species: Synthetic
Genetic Insert: Optopatch2
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910
Proper citation: RRID:Addgene_51694 Copy
Species: Synthetic
Genetic Insert: Optopatch1
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910
Proper citation: RRID:Addgene_51695 Copy
Genetic Insert: EMCV IRES
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22718970
Proper citation: RRID:Addgene_51733 Copy
Species: Homo sapiens
Genetic Insert: SirT1
Vector Backbone Description: Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390637
Proper citation: RRID:Addgene_51746 Copy
Species: Homo sapiens
Genetic Insert: EPHB1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 19
Proper citation: RRID:Addgene_51750 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51762 Copy
Genetic Insert: pp1 beta
Vector Backbone Description: Backbone Marker:Peti Lab (Addgene Plasmid# 26563); Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_51769 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGAGCGCACCATCTTCTTCA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51763 Copy
Species: Rattus norvegicus
Genetic Insert: Chimeric Synaptophysin-mCherry-Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24529383
Proper citation: RRID:Addgene_51819 Copy
Genetic Insert: humanized S.pyogenes Cas9
Vector Backbone Description: Backbone Size:4071; Vector Backbone:pCS2; Vector Types:Mammalian Expression, CRISPR, medaka, zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24728957
Comments: This plasmid is modified from pX330-U6-Chimeric BB-CBh-hSpCas9 originated from Feng Zhang Lab.
Proper citation: RRID:Addgene_51815 Copy
Species: O. latipes
Genetic Insert: Tol2 Transposase
Vector Backbone Description: Vector Backbone:pBluscript II SK+; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24504478
Proper citation: RRID:Addgene_51818 Copy
Genetic Insert: 9x NFAT binding site
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL-3 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14656927
Proper citation: RRID:Addgene_51941 Copy
Species: Homo sapiens
Genetic Insert: TMED10
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 48
Proper citation: RRID:Addgene_51852 Copy
Species: Homo sapiens
Genetic Insert: PEAR1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 55
Proper citation: RRID:Addgene_51860 Copy
Species: Homo sapiens
Genetic Insert: CD109
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 90
Proper citation: RRID:Addgene_51862 Copy
Species: Homo sapiens
Genetic Insert: VIPR1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 97
Proper citation: RRID:Addgene_51865 Copy
Species: Mus musculus
Genetic Insert: improved Cre recombinase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412418
Proper citation: RRID:Addgene_51904 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
