Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29526710
Proper citation: RRID:Addgene_229771 Copy
Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41648453
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.
Proper citation: RRID:Addgene_233024 Copy
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227580 Copy
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240159 Copy
Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240158 Copy
Species: Mycobacterium smegmatis MC2-155
Genetic Insert: 3' rpoC(MSMEG_1368)-ALFA
Vector Backbone Description: Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:40576343
Proper citation: RRID:Addgene_252904 Copy
Species: synthetic gene derived from Tn10 tetR
Genetic Insert: Psmyc-tetR#28
Vector Backbone Description: Backbone Size:5133; Vector Backbone:pTE-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:19174563
Comments: There are minor discrepancies between depositor's and Addgene's sequence. Depositor is aware of these and thinks they should not have any affect on function.
Proper citation: RRID:Addgene_20319 Copy
Vector Backbone Description: Backbone Size:9662; Vector Backbone:pBAC2015, pQS-gusA, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227508 Copy
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pGM1190; Vector Types:CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227582 Copy
Species: Neonothopanus nambi
Genetic Insert: pGAP - nnH3H_v2 - tAOX
Vector Backbone Description: Backbone Size:4113; Vector Backbone:Level 1-like; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38253843
Proper citation: RRID:Addgene_219752 Copy
Species: Aspergillus nidulans
Genetic Insert: pGAP - npgA - tAOX
Vector Backbone Description: Backbone Size:3503; Vector Backbone:Level 1-like; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38253843
Proper citation: RRID:Addgene_219750 Copy
Genetic Insert: none, cloning vector for introduction of targeting sequences
Vector Backbone Description: Vector Backbone:pCHERRY3 : pAL5000/colE1 origins; Vector Types:CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38319218
Proper citation: RRID:Addgene_221387 Copy
Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.
Proper citation: RRID:Addgene_222351 Copy
Vector Backbone Description: Backbone Marker:Matthew Bennett; Backbone Size:5611; Vector Backbone:pYUBcLIC-GFP; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35750296
Comments: pYUB vector backbone originates from pYUB28b (Addgene plasmid # 37277 ; http://n2t.net/addgene:37277 ; RRID:Addgene_37277).
Reference: Metabolic engineering of cofactor F420 production in Mycobacterium smegmatis. Bashiri G, Rehan AM, Greenwood DR, Dickson JM, Baker EN. PLoS One. 2010 Dec 29;5(12):e15803. doi: 10.1371/journal.pone.0015803 PubMed 21209917
****
LIC cassette together with folding reporter GFP and purification tag sequence originate from pREcLIC-GFP.
Reference: Geertsma, E., Poolman, B. High-throughput cloning and expression in recalcitrant bacteria. Nat Methods 4, 705–707 (2007). doi: 10.1038/nmeth1073 PubMed 17643108
Proper citation: RRID:Addgene_183509 Copy
Genetic Insert: GFP(47TAG)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28276676
Comments: Plasmid was originally reported by the Peter Schultz lab in Wang, Schultz et al. PLoS One 2010, doi: 10.1371/journal.pone.0009354. Please see associated publication Ganapathy, Seeliger et al. for full details regarding any additional cloning that was performed.
Proper citation: RRID:Addgene_193251 Copy
Species: Synthetic
Genetic Insert: attR
Vector Backbone Description: Backbone Marker:Aubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp; Backbone Size:5835; Vector Backbone:pOSV805; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35456877
Proper citation: RRID:Addgene_172194 Copy
Species: Synthetic
Genetic Insert: EBFP2-LaminB1
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184460 Copy
Species: Synthetic
Genetic Insert: iRFP702-3xNLS
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184454 Copy
Species: Synthetic
Genetic Insert: mCardinal-LaminB1
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184452 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
