Plasmids   Select Another Resource Report Type

http://www.addgene.org/230032

Genetic Insert: MG1655 attP21::PR-mCerulean::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.

Proper citation: RRID:Addgene_230032 Copy   

•   Source: Addgene
  

http://www.addgene.org/230038

Genetic Insert: MG1655 attP21::PR-mCherry::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG

Proper citation: RRID:Addgene_230038 Copy   

•   Source: Addgene
  

http://www.addgene.org/230037

Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG

Proper citation: RRID:Addgene_230037 Copy   

•   Source: Addgene
  

http://www.addgene.org/234550

Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:34411545
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC.

Proper citation: RRID:Addgene_234550 Copy   

•   Source: Addgene
  

http://www.addgene.org/229552

Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of hisL knock-out: Fwd - prEP229, gtgaggataagaggtggcga Rev - prEP230, tcctttccccgctcattcat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229552 Copy   

•   Source: Addgene
  

http://www.addgene.org/229551

Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229551 Copy   

•   Source: Addgene
  

http://www.addgene.org/229549

Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of metB knock-out: Fwd - prEP213, acgatcggtctggcttagtt Rev - prEP214, tgaccgtaaacccgcatagt Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229549 Copy   

•   Source: Addgene
  

http://www.addgene.org/229548

Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of hisD knock-out: Fwd - prEP209, ccggttttacgcctgcatat Rev - prEP210, ccgaacgcccaactattctg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229548 Copy   

•   Source: Addgene
  

http://www.addgene.org/229547

Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229547 Copy   

•   Source: Addgene
  

http://www.addgene.org/229550

Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229550 Copy   

•   Source: Addgene
  

http://www.addgene.org/234837

Genetic Insert: ΔrpiAB Δedd strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None

Proper citation: RRID:Addgene_234837 Copy   

•   Source: Addgene
  

http://www.addgene.org/102264

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102264 Copy   

•   Source: Addgene
  

http://www.addgene.org/102260

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102260 Copy   

•   Source: Addgene
  

http://www.addgene.org/102261

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102261 Copy   

•   Source: Addgene
  

http://www.addgene.org/102258

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102258 Copy   

•   Source: Addgene
  

http://www.addgene.org/102259

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102259 Copy   

•   Source: Addgene
  

http://www.addgene.org/102268

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102268 Copy   

•   Source: Addgene
  

http://www.addgene.org/102269

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102269 Copy   

•   Source: Addgene
  

http://www.addgene.org/102804

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102804 Copy   

•   Source: Addgene
  

http://www.addgene.org/102800

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102800 Copy   

•   Source: Addgene