Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 211 results
Snippet view Table view Download 211 Result(s)
Click the to add this resource to a Collection

http://www.addgene.org/229771

Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29526710

Proper citation: RRID:Addgene_229771 Copy   


  • RRID:Addgene_233024

http://www.addgene.org/233024

Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41648453
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.

Proper citation: RRID:Addgene_233024 Copy   


  • RRID:Addgene_227580

http://www.addgene.org/227580

Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857

Proper citation: RRID:Addgene_227580 Copy   


  • RRID:Addgene_209018

http://www.addgene.org/209018

Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).

Proper citation: RRID:Addgene_209018 Copy   


  • RRID:Addgene_240159

    This resource has 1+ mentions.

http://www.addgene.org/240159

Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969

Proper citation: RRID:Addgene_240159 Copy   


  • RRID:Addgene_240158

    This resource has 1+ mentions.

http://www.addgene.org/240158

Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969

Proper citation: RRID:Addgene_240158 Copy   


  • RRID:Addgene_252904

http://www.addgene.org/252904

Species: Mycobacterium smegmatis MC2-155
Genetic Insert: 3' rpoC(MSMEG_1368)-ALFA
Vector Backbone Description: Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:40576343

Proper citation: RRID:Addgene_252904 Copy   


  • RRID:Addgene_20319

http://www.addgene.org/20319

Species: synthetic gene derived from Tn10 tetR
Genetic Insert: Psmyc-tetR#28
Vector Backbone Description: Backbone Size:5133; Vector Backbone:pTE-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:19174563
Comments: There are minor discrepancies between depositor's and Addgene's sequence. Depositor is aware of these and thinks they should not have any affect on function.

Proper citation: RRID:Addgene_20319 Copy   


  • RRID:Addgene_227508

http://www.addgene.org/227508

Vector Backbone Description: Backbone Size:9662; Vector Backbone:pBAC2015, pQS-gusA, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857

Proper citation: RRID:Addgene_227508 Copy   


  • RRID:Addgene_227582

http://www.addgene.org/227582

Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pGM1190; Vector Types:CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857

Proper citation: RRID:Addgene_227582 Copy   


  • RRID:Addgene_219752

http://www.addgene.org/219752

Species: Neonothopanus nambi
Genetic Insert: pGAP - nnH3H_v2 - tAOX
Vector Backbone Description: Backbone Size:4113; Vector Backbone:Level 1-like; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38253843

Proper citation: RRID:Addgene_219752 Copy   


  • RRID:Addgene_219750

http://www.addgene.org/219750

Species: Aspergillus nidulans
Genetic Insert: pGAP - npgA - tAOX
Vector Backbone Description: Backbone Size:3503; Vector Backbone:Level 1-like; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38253843

Proper citation: RRID:Addgene_219750 Copy   


  • RRID:Addgene_221387

http://www.addgene.org/221387

Genetic Insert: none, cloning vector for introduction of targeting sequences
Vector Backbone Description: Vector Backbone:pCHERRY3 : pAL5000/colE1 origins; Vector Types:CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38319218

Proper citation: RRID:Addgene_221387 Copy   


  • RRID:Addgene_222351

http://www.addgene.org/222351

Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.

Proper citation: RRID:Addgene_222351 Copy   


  • RRID:Addgene_183509

http://www.addgene.org/183509

Vector Backbone Description: Backbone Marker:Matthew Bennett; Backbone Size:5611; Vector Backbone:pYUBcLIC-GFP; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35750296
Comments: pYUB vector backbone originates from pYUB28b (Addgene plasmid # 37277 ; http://n2t.net/addgene:37277 ; RRID:Addgene_37277). Reference: Metabolic engineering of cofactor F420 production in Mycobacterium smegmatis. Bashiri G, Rehan AM, Greenwood DR, Dickson JM, Baker EN. PLoS One. 2010 Dec 29;5(12):e15803. doi: 10.1371/journal.pone.0015803 PubMed 21209917 **** LIC cassette together with folding reporter GFP and purification tag sequence originate from pREcLIC-GFP. Reference: Geertsma, E., Poolman, B. High-throughput cloning and expression in recalcitrant bacteria. Nat Methods 4, 705–707 (2007). doi: 10.1038/nmeth1073 PubMed 17643108

Proper citation: RRID:Addgene_183509 Copy   


http://www.addgene.org/193251

Genetic Insert: GFP(47TAG)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28276676
Comments: Plasmid was originally reported by the Peter Schultz lab in Wang, Schultz et al. PLoS One 2010, doi: 10.1371/journal.pone.0009354. Please see associated publication Ganapathy, Seeliger et al. for full details regarding any additional cloning that was performed.

Proper citation: RRID:Addgene_193251 Copy   


  • RRID:Addgene_172194

http://www.addgene.org/172194

Species: Synthetic
Genetic Insert: attR
Vector Backbone Description: Backbone Marker:Aubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp; Backbone Size:5835; Vector Backbone:pOSV805; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35456877

Proper citation: RRID:Addgene_172194 Copy   


  • RRID:Addgene_184460

http://www.addgene.org/184460

Species: Synthetic
Genetic Insert: EBFP2-LaminB1
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160

Proper citation: RRID:Addgene_184460 Copy   


  • RRID:Addgene_184454

    This resource has 1+ mentions.

http://www.addgene.org/184454

Species: Synthetic
Genetic Insert: iRFP702-3xNLS
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160

Proper citation: RRID:Addgene_184454 Copy   


  • RRID:Addgene_184452

    This resource has 1+ mentions.

http://www.addgene.org/184452

Species: Synthetic
Genetic Insert: mCardinal-LaminB1
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160

Proper citation: RRID:Addgene_184452 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X