Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pJMP12089 Resource Report Resource Website |
RRID:Addgene_222357 | Hygromycin | PMID:39302127 | Tn7 expression vector. | Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:30:13 | 0 | |||
|
pEB multi-Hyg Human collagen type IV alpha 4 chain (COL4A4) Resource Report Resource Website |
RRID:Addgene_229771 | Human collagen type IV alpha 4 chain (COL4A4) | Homo sapiens | Hygromycin | PMID:29526710 | Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:32:22 | 0 | ||
|
pUMN105 Resource Report Resource Website |
RRID:Addgene_233024 | Hygromycin | PMID:41648453 | Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint. | Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin | 2026-08-15 01:32:24 | 0 | |||
|
pAJF1124 Resource Report Resource Website |
RRID:Addgene_252904 | 3' rpoC(MSMEG_1368)-ALFA | Mycobacterium smegmatis MC2-155 | Hygromycin | PMID:40576343 | Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:35:31 | 0 | ||
|
C-5545 ∆cosδε Resource Report Resource Website |
RRID:Addgene_209018 | Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes | Escherichia coli | Hygromycin | PMID:33317264 | P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp). | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin | 2026-08-15 01:31:41 | 0 | |
|
pSMT3-lpqZ-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_240159 | lpqZ | Mycobacterium marinum | Hygromycin | PMID:41384969 | Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:34:37 | 1 | ||
|
pSMT3-fecB Resource Report Resource Website 1+ mentions |
RRID:Addgene_240158 | fecB (MMAR_1650) | Mycobacterium marinum | Hygromycin | PMID:41384969 | Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:34:38 | 1 | ||
|
pVITRO-Fab_Theo-LUCID Resource Report Resource Website |
RRID:Addgene_119048 | Fab_Theo-LUCID_part1 | Synthetic | Hygromycin | PMID:28510347 | Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:03:09 | 0 | ||
|
pDD108 Resource Report Resource Website |
RRID:Addgene_119884 | BbaJ23104_EYFP | Hygromycin | PMID:29366319 | Vector Backbone:p15a; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:03:18 | 0 | |||
|
pSIMcpf1 Resource Report Resource Website |
RRID:Addgene_153034 | Ascpf1 | Acidaminococcus sp. BV3L6 | Hygromycin | PMID:33710766 | Vector Backbone:pSIM18; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:32 | 0 | ||
|
pKCyR8 Resource Report Resource Website |
RRID:Addgene_149494 | CymR(AM)-mRFP | Synthetic | Hygromycin | PMID:34125913 | Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:15 | 0 | ||
|
pBSV2H_Psyn-sgRNA500 Resource Report Resource Website |
RRID:Addgene_149559 | Hygromycin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:17 | 0 | ||||
|
pBSV2H_Psyn-sgRNAftsI Resource Report Resource Website |
RRID:Addgene_149563 | sgRNAftsI | Synthetic | Hygromycin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:16 | 0 | ||
|
pBbdCas9H(RBSmut)_arr2 Resource Report Resource Website |
RRID:Addgene_149580 | Hygromycin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H(RBSmut); Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:16 | 0 | ||||
|
pBbdCas9H_arr2 Resource Report Resource Website |
RRID:Addgene_149573 | Hygromycin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin | 2026-08-15 01:07:16 | 0 | ||||
|
pJDC124 Resource Report Resource Website |
RRID:Addgene_157877 | mCherry | Hygromycin | PMID:26934495 | Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:08:09 | 0 | |||
|
pCR-Hyg Resource Report Resource Website 1+ mentions |
RRID:Addgene_158708 | crRNA | Other | Hygromycin | PMID:28646112 | Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function. | Backbone Marker:from Houhui Song's Lab; Vector Backbone:pSL001; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Mycobacteria Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:08:19 | 1 | |
|
pYC2085 Resource Report Resource Website |
RRID:Addgene_158721 | Sth1 sgRNA scaffold | Other | Hygromycin | PMID:31992616 | insert sizes: 171 bp and 3366 bp | Vector Backbone:custom design; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin | 2026-08-15 01:08:21 | 0 | |
|
pCOND (Hyg) Resource Report Resource Website |
RRID:Addgene_110093 | Hygromycin | PMID:29934571 | Vector Backbone:pCOND; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin | 2026-08-15 01:01:36 | 0 | ||||
|
pKO (Hyg) Resource Report Resource Website |
RRID:Addgene_110087 | Hygromycin | PMID:29934571 | Vector Backbone:pKO; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin | 2026-08-15 01:01:36 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
