Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29526710
Proper citation: RRID:Addgene_229771 Copy
Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41648453
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.
Proper citation: RRID:Addgene_233024 Copy
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227580 Copy
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240159 Copy
Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240158 Copy
Species: Mycobacterium smegmatis MC2-155
Genetic Insert: 3' rpoC(MSMEG_1368)-ALFA
Vector Backbone Description: Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:40576343
Proper citation: RRID:Addgene_252904 Copy
Species: Synthetic
Genetic Insert: Fab_Theo-LUCID_part1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28510347
Proper citation: RRID:Addgene_119048 Copy
Genetic Insert: BbaJ23104_EYFP
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29366319
Proper citation: RRID:Addgene_119884 Copy
Species: Acidaminococcus sp. BV3L6
Genetic Insert: Ascpf1
Vector Backbone Description: Vector Backbone:pSIM18; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33710766
Proper citation: RRID:Addgene_153034 Copy
Species: Synthetic
Genetic Insert: CymR(AM)-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_149494 Copy
Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311
Proper citation: RRID:Addgene_149559 Copy
Species: Synthetic
Genetic Insert: sgRNAftsI
Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311
Proper citation: RRID:Addgene_149563 Copy
Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H(RBSmut); Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311
Proper citation: RRID:Addgene_149580 Copy
Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311
Proper citation: RRID:Addgene_149573 Copy
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:26934495
Proper citation: RRID:Addgene_157877 Copy
Species: Other
Genetic Insert: crRNA
Vector Backbone Description: Backbone Marker:from Houhui Song's Lab; Vector Backbone:pSL001; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Mycobacteria Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28646112
Comments: Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function.
Proper citation: RRID:Addgene_158708 Copy
Species: Other
Genetic Insert: Sth1 sgRNA scaffold
Vector Backbone Description: Vector Backbone:custom design; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:31992616
Comments: insert sizes: 171 bp and 3366 bp
Proper citation: RRID:Addgene_158721 Copy
Vector Backbone Description: Vector Backbone:pCOND; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29934571
Proper citation: RRID:Addgene_110093 Copy
Vector Backbone Description: Vector Backbone:pKO; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29934571
Proper citation: RRID:Addgene_110087 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.