Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 211 results
Snippet view Table view Download 211 Result(s)
Click the to add this resource to a Collection

http://www.addgene.org/229771

Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29526710

Proper citation: RRID:Addgene_229771 Copy   


  • RRID:Addgene_233024

http://www.addgene.org/233024

Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41648453
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.

Proper citation: RRID:Addgene_233024 Copy   


  • RRID:Addgene_227580

http://www.addgene.org/227580

Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857

Proper citation: RRID:Addgene_227580 Copy   


  • RRID:Addgene_209018

http://www.addgene.org/209018

Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).

Proper citation: RRID:Addgene_209018 Copy   


  • RRID:Addgene_240159

    This resource has 1+ mentions.

http://www.addgene.org/240159

Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969

Proper citation: RRID:Addgene_240159 Copy   


  • RRID:Addgene_240158

    This resource has 1+ mentions.

http://www.addgene.org/240158

Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969

Proper citation: RRID:Addgene_240158 Copy   


  • RRID:Addgene_252904

http://www.addgene.org/252904

Species: Mycobacterium smegmatis MC2-155
Genetic Insert: 3' rpoC(MSMEG_1368)-ALFA
Vector Backbone Description: Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:40576343

Proper citation: RRID:Addgene_252904 Copy   


http://www.addgene.org/119048

Species: Synthetic
Genetic Insert: Fab_Theo-LUCID_part1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28510347

Proper citation: RRID:Addgene_119048 Copy   


  • RRID:Addgene_119884

http://www.addgene.org/119884

Genetic Insert: BbaJ23104_EYFP
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29366319

Proper citation: RRID:Addgene_119884 Copy   


  • RRID:Addgene_153034

http://www.addgene.org/153034

Species: Acidaminococcus sp. BV3L6
Genetic Insert: Ascpf1
Vector Backbone Description: Vector Backbone:pSIM18; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33710766

Proper citation: RRID:Addgene_153034 Copy   


  • RRID:Addgene_149494

http://www.addgene.org/149494

Species: Synthetic
Genetic Insert: CymR(AM)-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34125913

Proper citation: RRID:Addgene_149494 Copy   


  • RRID:Addgene_149559

http://www.addgene.org/149559

Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311

Proper citation: RRID:Addgene_149559 Copy   


http://www.addgene.org/149563

Species: Synthetic
Genetic Insert: sgRNAftsI
Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBSV2H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311

Proper citation: RRID:Addgene_149563 Copy   


http://www.addgene.org/149580

Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H(RBSmut); Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311

Proper citation: RRID:Addgene_149580 Copy   


  • RRID:Addgene_149573

http://www.addgene.org/149573

Vector Backbone Description: Backbone Marker:CJW lab; Vector Backbone:pBbdCas9H; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33257311

Proper citation: RRID:Addgene_149573 Copy   


  • RRID:Addgene_157877

http://www.addgene.org/157877

Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:26934495

Proper citation: RRID:Addgene_157877 Copy   


  • RRID:Addgene_158708

    This resource has 1+ mentions.

http://www.addgene.org/158708

Species: Other
Genetic Insert: crRNA
Vector Backbone Description: Backbone Marker:from Houhui Song's Lab; Vector Backbone:pSL001; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology, Mycobacteria Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28646112
Comments: Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function.

Proper citation: RRID:Addgene_158708 Copy   


  • RRID:Addgene_158721

http://www.addgene.org/158721

Species: Other
Genetic Insert: Sth1 sgRNA scaffold
Vector Backbone Description: Vector Backbone:custom design; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:31992616
Comments: insert sizes: 171 bp and 3366 bp

Proper citation: RRID:Addgene_158721 Copy   


  • RRID:Addgene_110093

http://www.addgene.org/110093

Vector Backbone Description: Vector Backbone:pCOND; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29934571

Proper citation: RRID:Addgene_110093 Copy   


  • RRID:Addgene_110087

http://www.addgene.org/110087

Vector Backbone Description: Vector Backbone:pKO; Vector Types:Bacterial Knockout Generation; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29934571

Proper citation: RRID:Addgene_110087 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X