Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
TB204 △metB proB74 Resource Report Resource Website |
RRID:Addgene_229551 | MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | Addgene | 2026-09-26 02:51:58 | 0 |
|
TB204 △metB Resource Report Resource Website |
RRID:Addgene_229549 | MG1655 attP21::PR-sfGFP::frt metB:frt | n/a | None | PMID:40509754 | Primers for sequence verification of metB knock-out: Fwd - prEP213, acgatcggtctggcttagtt Rev - prEP214, tgaccgtaaacccgcatagt Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:51:58 | 0 | |
|
TB204 △hisD Resource Report Resource Website |
RRID:Addgene_229548 | MG1655 attP21::PR-sfGFP::frt hisD:frt | n/a | None | PMID:40509754 | Primers for sequence verification of hisD knock-out: Fwd - prEP209, ccggttttacgcctgcatat Rev - prEP210, ccgaacgcccaactattctg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:51:58 | 0 | |
|
TB204 △trpC proB74 Resource Report Resource Website |
RRID:Addgene_229547 | MG1655 attP21::PR-sfGFP::frt trpC::frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | Addgene | 2026-09-26 02:51:58 | 0 |
|
TB204 △hisD proB74 Resource Report Resource Website |
RRID:Addgene_229550 | MG1655 attP21::PR-sfGFP::frt hisD:frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | Addgene | 2026-09-26 02:51:58 | 0 |
|
Δrpi Resource Report Resource Website |
RRID:Addgene_234837 | ΔrpiAB Δedd strain | None | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:52:23 | 0 | ||||
|
SHARK2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248173 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:54:09 | 1 | ||
|
SHARK7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248175 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir116-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:54:09 | 1 | ||
|
E. coli BW25113 ΔphoP:PcpcG2-phoP*** (CMB259) Resource Report Resource Website |
RRID:Addgene_254897 | Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:54:52 | 0 | ||
|
E. coli BW25113:PcpcG2-tetR (CMB247) Resource Report Resource Website |
RRID:Addgene_254898 | Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:54:52 | 0 | ||
|
MG1655-Chromosomal rfp reporter Resource Report Resource Website |
RRID:Addgene_251806 | E. coli K-12 MG1655 | n/a | None | Primers used for Colony PCR Verification: Forward primer = CGTGAGCGGTAAAGTTGTTG Reverse primer = CGGAGCTGCAAGGTGTTTATAG | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-09-26 02:55:17 | 0 | ||
|
BL21ΔBF Resource Report Resource Website |
RRID:Addgene_102264 | None | PMID:29164072 | Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔAB Resource Report Resource Website |
RRID:Addgene_102260 | None | PMID:29164072 | Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔAC Resource Report Resource Website |
RRID:Addgene_102261 | None | PMID:29164072 | Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔC Resource Report Resource Website |
RRID:Addgene_102258 | None | PMID:29164072 | Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔF Resource Report Resource Website |
RRID:Addgene_102259 | None | PMID:29164072 | Genotype = ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔACF Resource Report Resource Website |
RRID:Addgene_102268 | None | PMID:29164072 | Genotype = ΔompA ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
BL21ΔBCF Resource Report Resource Website |
RRID:Addgene_102269 | None | PMID:29164072 | Genotype = ΔlamB ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:27 | 0 | |||
|
EH1 Resource Report Resource Website |
RRID:Addgene_102804 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:30 | 0 | ||
|
RF16 Resource Report Resource Website |
RRID:Addgene_102800 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:30 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
