Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:none (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

199 Results - per page

Show More Columns | Download 199 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
TB205
 
Resource Report
Resource Website
RRID:Addgene_230034 MG1655 attP21::PR-mCherry::frt None PMID:28428424 Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-15 01:31:48 0
TB204
 
Resource Report
Resource Website
RRID:Addgene_230033 MG1655 attP21::PR-sfGFP::frt None PMID:29355812 Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-15 01:31:48 0
TB202
 
Resource Report
Resource Website
RRID:Addgene_230032 MG1655 attP21::PR-mCerulean::frt None Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-15 01:31:48 0
TB205 △trpC
 
Resource Report
Resource Website
RRID:Addgene_230038 MG1655 attP21::PR-mCherry::frt trpC::frt None PMID:32042125 Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-15 01:31:47 0
TB204 △trpC
 
Resource Report
Resource Website
RRID:Addgene_230037 MG1655 attP21::PR-sfGFP::frt trpC::frt None PMID:32042125 Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-15 01:31:47 0
SHARK2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_248173 N/A None PMID:41529903 K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None 2026-08-15 01:35:12 1
SHARK7
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_248175 N/A None PMID:41529903 K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir116-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None 2026-08-15 01:35:12 1
E. coli BW25113 ΔphoP:PcpcG2-phoP*** (CMB259)
 
Resource Report
Resource Website
RRID:Addgene_254897 Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus None PMID:41996246 For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-08-15 01:35:53 0
E. coli BW25113:PcpcG2-tetR (CMB247)
 
Resource Report
Resource Website
RRID:Addgene_254898 Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus None PMID:41996246 For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-08-15 01:35:53 0
E. coli BL21 (DE3) ΔEntD
 
Resource Report
Resource Website
RRID:Addgene_192874 The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene. E.coli None PMID:16709676 EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group. Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None 2026-08-15 01:27:45 0
MG1655-Chromosomal rfp reporter
 
Resource Report
Resource Website
RRID:Addgene_251806 E. coli K-12 MG1655 n/a None Primers used for Colony PCR Verification: Forward primer = CGTGAGCGGTAAAGTTGTTG Reverse primer = CGGAGCTGCAAGGTGTTTATAG Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None 2026-08-15 01:36:18 0
FD1
 
Resource Report
Resource Website
RRID:Addgene_125258 single chromosomal copy of yhhX target sequence upstream from mcherry reporter gene under control of a constitutive promoter None PMID:31377338 Genotype: The expression of mcherry can be visualized or measured with a spectrophotometer. The yhhX target sequence followed by a mcherry reporter gene carried by an integrative vector based on pOSIP-KL was integrated at the lambda attB site in the chromosome of E. coli MG1655 and the backbone was flipped out using the pE-FLP (AmpR, #45978, Addgene) plasmid. This strain can be used to optimize dCas9 expression levels Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:04:15 0
LC-E75
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_115925 none None PMID:29765036 E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-CO-RBS-librarydCas9 (2-3)* *Number in parentheses refers to the selected colony number. mCherry quantifies dCas9 repression Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:02:38 3
EH1
 
Resource Report
Resource Website
RRID:Addgene_102804 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:26 0
RF16
 
Resource Report
Resource Website
RRID:Addgene_102800 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:26 0
RF17
 
Resource Report
Resource Website
RRID:Addgene_102801 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:26 0
BL21ΔBF
 
Resource Report
Resource Website
RRID:Addgene_102264 None PMID:29164072 Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:23 0
BL21ΔAB
 
Resource Report
Resource Website
RRID:Addgene_102260 None PMID:29164072 Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:23 0
BL21ΔAC
 
Resource Report
Resource Website
RRID:Addgene_102261 None PMID:29164072 Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:22 0
BL21ΔC
 
Resource Report
Resource Website
RRID:Addgene_102258 None PMID:29164072 Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-08-15 01:00:22 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.