Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229547 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation:
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229550 Copy
Species: other
Genetic Insert: BBa_J23119-RiboJ-RBS(21992)-gfpmut3
Vector Backbone Description: Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214744 Copy
Species: other
Genetic Insert: BBa_J23119-RiboJ-RBS(21992)-gfpmut3
Vector Backbone Description: Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Proper citation: RRID:Addgene_214745 Copy
Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains mutations in the five C-terminal amino acids of mCherry. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214749 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28667117
Comments: The edited genome file is available on this GitHub repository: https://github.com/barricklab/Abaylyi-EE.
Proper citation: RRID:Addgene_216551 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Species: n/a
Genetic Insert: E. coli K-12 MG1655
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Primers used for Colony PCR Verification:
Forward primer = CGTGAGCGGTAAAGTTGTTG
Reverse primer = CGGAGCTGCAAGGTGTTTATAG
Proper citation: RRID:Addgene_251806 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-B0033-PirWT-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248173 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir116-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248175 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:34411545
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC.
Proper citation: RRID:Addgene_234550 Copy
Species: n/a
Genetic Insert: exoI- recJ- araB::T7RNAP-tetA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Strain was validated by shotgun sequencing using Illumina Nextseq.
Supporting References:
Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6.
González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050.
Proper citation: RRID:Addgene_220588 Copy
Species: other
Genetic Insert: BBa_J23119-RiboJ-RBS(21992)-gfpmut3
Vector Backbone Description: Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Proper citation: RRID:Addgene_214746 Copy
Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214747 Copy
Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214748 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.
Proper citation: RRID:Addgene_34928 Copy
Genetic Insert: P-R-lox-TT-lox-catT172A
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_188480 Copy
Genetic Insert: Ptet-Rtet-lox-TT-lox-tetA
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_188481 Copy
Genetic Insert: P**-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_188477 Copy
Genetic Insert: P-R*-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_188478 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
