Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pInducer20_EGFP
 
Resource Report
Resource Website 		RRID:Addgene_228878 EGFP Ampicillin PMID:39502361 Control vector for expression of EGFP Backbone Marker:Addgene #44012; Vector Backbone:pInducer20; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:03 0
pAV-CAG-Sun1-GFP-WPRE-BC4-pA
 
Resource Report
Resource Website 		RRID:Addgene_220756 Sun1-GFP-WPRE-BC4 Synthetic Ampicillin PMID:40593543 Please visit https://doi.org/10.1101/2024.04.24.590975 for bioRxiv preprint. Backbone Marker:Samineni Lab (Addgene #220752); Vector Backbone:pAV-CAG-Sun1-GFP-WPRE-pA; Vector Types:AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:04 0
Halo-TCAB1 KI sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_207611 CCAAAGTCTTCATACTGCAG Homo sapiens Ampicillin PMID:37267110 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:06 0
pcDNA3.3_3xFLAG_SUMO_Eu1_HsAGO2(R710A, H712A)
 
Resource Report
Resource Website 		RRID:Addgene_231383 Human Argonaute2 Homo sapiens Ampicillin PMID:39932188 With engineered orthogonal SUMO_Eu1 (Vera Rodriguez et al., JCB 2019) in N-terminal tag. Please visit https://doi.org/10.1101/2024.08.19.608718 for bioRxiv preprint. Backbone Size:5413; Vector Backbone:pcDNA3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R710A, H712A Addgene 2026-10-10 02:09:05 0
pcDNA3.3_3xFLAG_SUMO_Eu1_HsAGO2(EI 5xE)
 
Resource Report
Resource Website 		RRID:Addgene_231385 Human Argonaute2 Homo sapiens Ampicillin PMID:39932188 With engineered orthogonal SUMO_Eu1 (Vera Rodriguez et al., JCB 2019) in N-terminal tag. Please visit https://doi.org/10.1101/2024.08.19.608718 for bioRxiv preprint. Backbone Size:5413; Vector Backbone:pcDNA3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S824E, S828E, T830E, S831E, S834E Addgene 2026-10-10 02:09:05 0
pcDNA3puro-mGFP-FXR1a-CC1mut (N202P)
 
Resource Report
Resource Website 		RRID:Addgene_225455 FXR1 isoform a Homo sapiens Ampicillin PMID:37961296 Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint. Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N202P Addgene 2026-10-10 02:09:05 0
pVG123
 
Resource Report
Resource Website 		RRID:Addgene_227755 EL222 codon-optimized for budding yeast Saccharomyces cerevisiae Ampicillin PMID:41794024 For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint. Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Ala157Val mutant Addgene 2026-10-10 02:09:05 0
pAAV-anti-GFP(LaG16) PAGER(Gi)
 
Resource Report
Resource Website 		RRID:Addgene_230008 MT1-LaG16-TEVcs-ALFA-hM4D Synthetic Ampicillin PMID:39633047 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
pVG121
 
Resource Report
Resource Website 		RRID:Addgene_227757 EL222 codon-optimized for budding yeast Saccharomyces cerevisiae Ampicillin PMID:41794024 For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint. Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Gly80Glu mutant Addgene 2026-10-10 02:09:05 0
Halo-MDC1
 
Resource Report
Resource Website 		RRID:Addgene_207108 HaloTag-MDC1 Homo sapiens Ampicillin PMID:37341699 Backbone Size:5000; Vector Backbone:pHTN HaloTag CMV-neo (Promega; #G7721); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:06 0
pVG150
 
Resource Report
Resource Website 		RRID:Addgene_227759 EL222 codon-optimized for budding yeast Saccharomyces cerevisiae Ampicillin PMID:41794024 For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint. Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Ser137Asn mutant Addgene 2026-10-10 02:09:05 0
Halo-SHLD3 HRD
 
Resource Report
Resource Website 		RRID:Addgene_207077 HaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences Homo sapiens Ampicillin PMID:37341699 Backbone Size:4997; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
pJH4040
 
Resource Report
Resource Website 		RRID:Addgene_229803 Pgpc-1 wCherry unc-54 3' UTR Caenorhabditis elegans Ampicillin PMID:36857454 Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint. There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function. Backbone Marker:stratagene; Backbone Size:8784; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
ATM-Halo HRD
 
Resource Report
Resource Website 		RRID:Addgene_207082 HaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences Homo sapiens Ampicillin PMID:37341699 Backbone Size:5000; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
Halo-53BP1 HRD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_207087 HaloTag with internal PuroR cassette flanked by human 53BP1 locus sequences Homo sapiens Ampicillin PMID:37341699 Backbone Size:5000; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:06 1
pDL562
 
Resource Report
Resource Website 		RRID:Addgene_231162 mobile gRNA targeting SlCHL1 Solanum lycopersicum Kanamycin PMID:39284063 also contains mobile sequences from tRNAIleu Vector Backbone:pEE844; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:09:05 0
Halo-MDC1 HRD
 
Resource Report
Resource Website 		RRID:Addgene_207086 HaloTag with internal PuroR cassette flanked by human MDC1 locus sequences Homo sapiens Ampicillin PMID:37341699 Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
pEE834
 
Resource Report
Resource Website 		RRID:Addgene_231168 mobile gRNA targeting SlPDS Solanum lycopersicum Kanamycin PMID:39284063 also contains mobile sequences from Arabidopsis thaliana FT mRNA Vector Backbone:pEE083; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:09:05 0
pET21-pelB-GST-5
 
Resource Report
Resource Website 		RRID:Addgene_228987 GST-5 Lama glama Ampicillin PMID:39098531 Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:09:05 0
plko_TRE3G_nlsMyc-Sox9HMGtruncation_PGKpuroR
 
Resource Report
Resource Website 		RRID:Addgene_203964 SOX9-noHMG Mus musculus Ampicillin PMID:37488435 Backbone Size:-2; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin the HMG domain is truncated Addgene 2026-10-10 02:09:05 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch