Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
M3499 ura3::ADE2 Disruptor Converter
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51674 ADE2 Saccharomyces cerevisiae Ampicillin PMID:12898713 Plasmid M3499 (ura3::ADE2 ) was made by cutting pJJ244 with StuI and EcoRV and replacing the 248 bp StuI–EcoRV fragment with a 3.6 kb BamHI blunted with Klenow) fragment containing ADE2 from plasmid M1144. Vector Backbone:pJJ244; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 1
M3926 leu2::KanMX3 Disruptor Converter
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51680 KanMX3 Ampicillin PMID:12898713 Plasmid M3926 (leu2::KanMX3 ) was made by cutting YDp-L with EcoRV and inserting a 2.5 kb BglII–EcoRI (both ends blunted with Klenow)fragment containing KanMX3 from plasmid pFA6–KanMX3. Vector Backbone:YDp-L; Vector Types:Yeast Expression, yeast marker swap; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 1
SpyLigase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51722 SpyLigase Synthetic Ampicillin PMID:24639550 SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins. pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/ pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/ SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth Transform plasmid into BL21 DE3 RIPL for expression. Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 2
DRH296: FCK-Optopatch2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51694 Optopatch2 Synthetic Ampicillin PMID:24952910 Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 8
DRH335: FCK-Optopatch1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51695 Optopatch1 Synthetic Ampicillin PMID:24952910 Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 2
R5 EMCV
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51733 EMCV IRES Ampicillin PMID:22718970 Backbone Marker:Promega; Backbone Size:4600; Vector Backbone:pGl4.13; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:16:16 3
p413TEF-SirT1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51746 SirT1 Homo sapiens Ampicillin PMID:19390637 Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:17 2
EPHB1-bio-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51750 EPHB1 Homo sapiens Ampicillin PMID:25713122 Article ref 19 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:17 1
lentiCRISPR - EGFP sgRNA 3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51762 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGCCACAAGTTCAGCGTGTC These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:21 2
RP1B-PP1beta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51769 pp1 beta Kanamycin Backbone Marker:Peti Lab (Addgene Plasmid# 26563); Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Contains PP1 beta residues 6-327 2026-08-15 01:16:17 1
lentiCRISPR - EGFP sgRNA 4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51763 Cas9 Synthetic Ampicillin PMID:24336571 gRNA target sequence GGAGCGCACCATCTTCTTCA These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids. Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information. Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:17 4
Syn-ATP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51819 Chimeric Synaptophysin-mCherry-Luciferase Rattus norvegicus Ampicillin PMID:24529383 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Within WT luciferase gene, changed Threonine 214 to Alanine, changed Alanine 215 to Leucine, changed Isoleucine 232 to Alanine, changed Phenylalanine 295 to Leucine, changed Glutamic Acid 354 to Lysine, changed Isoleucine 423 to Leucine, and changed Aspartic Acid 436 to Glycine. 2026-08-15 01:16:21 4
pCS2+hSpCas9
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51815 humanized S.pyogenes Cas9 Ampicillin PMID:24728957 This plasmid is modified from pX330-U6-Chimeric BB-CBh-hSpCas9 originated from Feng Zhang Lab. Backbone Size:4071; Vector Backbone:pCS2; Vector Types:Mammalian Expression, CRISPR, medaka, zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:16:17 29
T7-TPase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51818 Tol2 Transposase O. latipes Ampicillin PMID:24504478 Vector Backbone:pBluscript II SK+; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-08-15 01:16:17 3
9X NFAT-apha-MHC-Luc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51941 9x NFAT binding site Ampicillin PMID:14656927 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL-3 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:16:18 2
TMED10-bio-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51852 TMED10 Homo sapiens Ampicillin PMID:25713122 Article ref 48 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:18 1
PEAR1-bio-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51860 PEAR1 Homo sapiens Ampicillin PMID:25713122 Article ref 55 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:18 1
CD109-bio-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51862 CD109 Homo sapiens Ampicillin PMID:25713122 Article ref 90 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:22 1
VIPR1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_51865 VIPR1 Homo sapiens Ampicillin PMID:25713122 Article ref 97 Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:22 2
paavCAG-iCre
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_51904 improved Cre recombinase Mus musculus Ampicillin PMID:24412418 Backbone Size:5000; Vector Backbone:paavCAG; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:16:22 19

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch