Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,957 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
HA-mDyn2 pcDNA3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36264 Dynamin 2 Mus musculus Ampicillin PMID:17463283 HA-tagged mouse dynamin 2 flanked by KpnI and XbaI sites. BamHI between N-terminal HA tag and beginning of dynamin coding seq. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 1
mTert-pBabe-puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36413 mTERT Mus musculus Ampicillin PMID:21732358 Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:10 5
pTK-Slug
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36986 slug Mus musculus Ampicillin PMID:22385965 Slug cDNA was PCR amplified from an IMAGE clone (Open Biosystems) and cloned into BamHI-XbaI sites of pTK380. Backbone Marker:Dr. Tal Kafri; Backbone Size:0; Vector Backbone:pTK380 (tetracycline inducible); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:11 6
pWPXL-Hes1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36983 Hes1 Mus musculus Ampicillin PMID:22385965 The mouse Hes1 cDNA was cloned between MluI and SpeI sites (blunted) in pWPXL. This resulted in replacement of the EGFP in the vector backbone with mouse Hes1. Backbone Marker:Trono lab (Addgene plasmid 12257); Backbone Size:10510; Vector Backbone:pWPXL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:11 2
pWPXL-c-Myc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36980 c-Myc Mus musculus Ampicillin PMID:22385965 The mouse c-myc cDNA was cloned between MluI and SpeI sites (blunted) in pWPXL. This resulted in replacement of the EGFP in the original vector with mouse c-myc. Backbone Marker:Trono lab (Addgene plasmid 12257); Backbone Size:10510; Vector Backbone:pWPXL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:11 2
pWPXL-Klf4
 
Resource Report
Resource Website 		RRID:Addgene_36981 Klf4 Mus musculus Ampicillin PMID:22385965 The mouse Klf4 cDNA was cloned between MluI and SpeI sites (blunted) in pWPXL. This resulted in replacement of the EGFP in the vector backbone with mouse Klf4. Backbone Marker:Trono lab (Addgene plasmid 12257); Backbone Size:10510; Vector Backbone:pWPXL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:12 0
pTK-Snail
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36976 Snail Mus musculus Ampicillin PMID:22385965 Snail cDNA was PCR amplified from IMAGE clone and cloned into BamHI-XbaI sites of pTK380. Backbone Marker:Dr. Tal Kafri; Backbone Size:0; Vector Backbone:pTK380 (tetracycline inducible); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:11 3
pLKO-puro-sh-mFAK B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37018 sh-mFAK B Mus musculus Ampicillin PMID:19502425 Backbone Marker:Weinberg lab ; Backbone Size:7032; Vector Backbone:pLKO.1 puro (Addgene plasmid 8453); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:12 1
pBS-Foxd3 in situ
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37098 Foxd3 Mus musculus Ampicillin PMID:9767163 Backbone Marker:Stratgene; Backbone Size:2900; Vector Backbone:pBS; Vector Types:In situ hybridization probe; Bacterial Resistance:Ampicillin 2026-08-15 01:14:12 1
pLKO.1-sh-mSox10-2
 
Resource Report
Resource Website 		RRID:Addgene_37007 sh-mSox10-2 Mus musculus Ampicillin PMID:22385965 Backbone Marker:Weinberg lab ; Backbone Size:7032; Vector Backbone:pLKO.1 puro (Addgene plasmid 8453); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:12 0
mMib1-FLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37116 Mib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1)) Mus musculus Kanamycin PMID:21903422 Backbone Marker:Agilent (Stratagene); Backbone Size:4319; Vector Backbone:pCMV-Tag4a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin ACC Kozak sequence added before ATG annotated. 2026-08-15 01:14:12 3
Lenti-Hb9-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37080 Hb9 GFP Mus musculus Ampicillin PMID:19041781 Expresses GFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons Backbone Marker:Inder Verma lab; Backbone Size:8466; Vector Backbone:CSCspPW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:12 6
mZO1-1 shRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37215 mouse ZO-1 shRNA Mus musculus Ampicillin pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV. Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 1
mZO1-2 shRNA
 
Resource Report
Resource Website 		RRID:Addgene_37216 mouse ZO-1 shRNA Mus musculus Ampicillin pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV. Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pDonor MCS Rosa26
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_37200 Rosa26 left targeting arm Mus musculus Ampicillin PMID:22169954 The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich. Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 10
Foxd3 CreERT2 RMCE Insertion Vector
 
Resource Report
Resource Website 		RRID:Addgene_37272 Foxd3 Mus musculus Ampicillin Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
pHygroMod-Foxd3-3xFlag
 
Resource Report
Resource Website 		RRID:Addgene_37274 Foxd3 Mus musculus Ampicillin Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector for RMCE; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
pFoxd3floxtv
 
Resource Report
Resource Website 		RRID:Addgene_37268 Foxd3 Mus musculus Ampicillin PMID:18367558 Backbone Size:3000; Vector Backbone:pPNT4; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pFoxd3IRESGFPtv
 
Resource Report
Resource Website 		RRID:Addgene_37266 Foxd3 Mus musculus Ampicillin PMID:12381664 Backbone Marker:Stratgene; Backbone Size:3000; Vector Backbone:pBS; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pCS2mFoxd3
 
Resource Report
Resource Website 		RRID:Addgene_37267 Foxd3 Mus musculus Ampicillin PMID:17092955 Please note the insert is comprised of the 1.4kb ORF surrounded by UTRs. Backbone Size:4095; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Overexpression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch