Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,397 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pattB-synaptobrevin-14-LEXA-QF-hsp70
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46123 LexA-QF Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pCaSpeR4-tubulin-QF#7m1
 
Resource Report
Resource Website 		RRID:Addgene_46128 QF#7m1 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-12-QFBDAD-G4MD50-761-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46121 QFBDAD-G4MD50-761 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-QFrco
 
Resource Report
Resource Website 		RRID:Addgene_46089 QFrco Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-13-QFBDAD-G4MD257-761-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46122 QFBDAD-G4MD257-761 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-4-QFBDMD-G4AD-hsp70
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46112 QFBDMD-G4AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pattB-synaptobrevin-5-G4BDMD-QFADM1-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46113 G4BDMD-QFADM1 Synthetic Ampicillin PMID:25581800 Please note that Addgene's sequencing results found single nucleotide mismatches at bp# mismatches at bp# 5029, 5458 and 5461 when compared to the full plasmid sequence. The depositing laboratory states that these differences are not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-9-QFMD184-475-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46118 QFMD184-475 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-10-QFMD475-650-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46119 QFMD475-650 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-7m1-QFBDADM1-hsp70
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46116 QF#7m1 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 3
pattB-synaptobrevin-8-QFAD184-214-hsp70
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46117 QFAD184-214 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pattB-synaptobrevin-3-QFBD-G4MDAD-hsp70
 
Resource Report
Resource Website 		RRID:Addgene_46111 QFBD-G4MDAD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-11-QFMD262-475
 
Resource Report
Resource Website 		RRID:Addgene_46101 QFMD262-475 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-10-QFMD475-650
 
Resource Report
Resource Website 		RRID:Addgene_46100 QFMD475-650 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pT7-gRNA
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_46759 gRNA core Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 68
pT3TS-nCas9n
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_46757 Cas9 Synthetic Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 131
pICH86966::AtU6p::sgRNA_PDS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46966 AtU6p::sgRNA_PDS Synthetic Kanamycin PMID:23929340 gRNA target sequence GCCGTTAATTTGAGAGTCCA Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 25
pEGFP-C1-FLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46956 FLAG tag Synthetic Kanamycin PMID:23897892 Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 9
pDD162 (Peft-3::Cas9 + Empty sgRNA)
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_47549 Cas9 Synthetic Ampicillin PMID:23995389 For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin Codon optimized and with synthetic introns for C. elegans 2026-08-15 01:15:42 164
Tet-pLKO-puro-SOX2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47540 SOX2 shRNA Synthetic Ampicillin PMID:22941189 Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:15:43 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch