Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 60 showing 1181 ~ 1200 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46948

    This resource has 10+ mentions.

http://www.addgene.org/46948

Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE-CAGS-W; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21307310

Proper citation: RRID:Addgene_46948 Copy   


  • RRID:Addgene_46949

    This resource has 1+ mentions.

http://www.addgene.org/46949

Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18228512

Proper citation: RRID:Addgene_46949 Copy   


  • RRID:Addgene_46944

    This resource has 1+ mentions.

http://www.addgene.org/46944

Species: Homo sapiens
Genetic Insert: Ap2a2-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46944 Copy   


  • RRID:Addgene_46942

    This resource has 1+ mentions.

http://www.addgene.org/46942

Species: Homo sapiens
Genetic Insert: Mitotrap
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46942 Copy   


  • RRID:Addgene_47

    This resource has 1+ mentions.

http://www.addgene.org/47

Species: Mus musculus
Genetic Insert: PGC-1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14744933
Comments: Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map.

Proper citation: RRID:Addgene_47 Copy   


  • RRID:Addgene_46926

    This resource has 10+ mentions.

http://www.addgene.org/46926

Species: Homo sapiens
Genetic Insert: 5X HRE of VEGF
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11774035
Comments: The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.

Proper citation: RRID:Addgene_46926 Copy   


  • RRID:Addgene_46924

    This resource has 1+ mentions.

http://www.addgene.org/46924

Species: Homo sapiens
Genetic Insert: Park2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23319602

Proper citation: RRID:Addgene_46924 Copy   


  • RRID:Addgene_46929

    This resource has 1+ mentions.

http://www.addgene.org/46929

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46929 Copy   


  • RRID:Addgene_46885

    This resource has 1+ mentions.

http://www.addgene.org/46885

Species: Homo sapiens
Genetic Insert: Uracil-N-glycosylase WT
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23721969

Proper citation: RRID:Addgene_46885 Copy   


  • RRID:Addgene_46886

    This resource has 1+ mentions.

http://www.addgene.org/46886

Vector Backbone Description: Backbone Size:8353; Vector Backbone:pMSP3535; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Erythromycin
Defining Citation: PMID:10964628
Comments: This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535 contains the Nisin-inducible PnisA promoter, and the pAMB1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequencew which includes a mutation in RepE- F229L. This however is thought to not affect plasmid function.

Proper citation: RRID:Addgene_46886 Copy   


  • RRID:Addgene_46887

    This resource has 1+ mentions.

http://www.addgene.org/46887

Vector Backbone Description: Backbone Size:8278; Vector Backbone:pMSP3535VA; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10964628
Comments: This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535VA contains the Nisin-inducible PnisA promoter, and the pVA380-1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Note: The theoretical full sequence uploaded here is NOT fully accurate - the NheI site at position 4414 has been lost, along with approximately 500bp of sequence in this region (compare the depositor's uploaded maps). The actual size of this plasmid is 8278 as listed here. The depositing lab has not resequenced the region in question, but the discrepancy does not affect plasmid function. Note: This plasmid has been shown to accumulate deletions when replicated in E. coli (or gram-negative bacteria). Screening transformants by restriction digest is recommended. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequence, but they are not thought to affect plasmid function.

Proper citation: RRID:Addgene_46887 Copy   


  • RRID:Addgene_46920

    This resource has 1+ mentions.

http://www.addgene.org/46920

Genetic Insert: dCas9
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: The Cas9 contains a N612K mutation that does not effect the function of the enzyme.

Proper citation: RRID:Addgene_46920 Copy   


  • RRID:Addgene_46914

    This resource has 1+ mentions.

http://www.addgene.org/46914

Genetic Insert: sgGFP-NT1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GAATAGCTCAGAGGCCGAGG

Proper citation: RRID:Addgene_46914 Copy   


  • RRID:Addgene_46915

    This resource has 1+ mentions.

http://www.addgene.org/46915

Genetic Insert: sgGAL4-1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT

Proper citation: RRID:Addgene_46915 Copy   


  • RRID:Addgene_46879

    This resource has 1+ mentions.

http://www.addgene.org/46879

Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22637478

Proper citation: RRID:Addgene_46879 Copy   


  • RRID:Addgene_46913

    This resource has 1+ mentions.

http://www.addgene.org/46913

Species: Homo sapiens
Genetic Insert: dCas9-p65AD-BFP fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981

Proper citation: RRID:Addgene_46913 Copy   


  • RRID:Addgene_46916

    This resource has 1+ mentions.

http://www.addgene.org/46916

Genetic Insert: sgGAL4-4
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GAACGACTAGTTAGGCGTGTA

Proper citation: RRID:Addgene_46916 Copy   


  • RRID:Addgene_46994

    This resource has 1+ mentions.

http://www.addgene.org/46994

Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627

Proper citation: RRID:Addgene_46994 Copy   


  • RRID:Addgene_46995

    This resource has 1+ mentions.

http://www.addgene.org/46995

Species: Mus musculus
Genetic Insert: becn1
Vector Backbone Description: Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23685627

Proper citation: RRID:Addgene_46995 Copy   


  • RRID:Addgene_46909

    This resource has 1+ mentions.

http://www.addgene.org/46909

Species: Homo sapiens
Genetic Insert: Tau E14 P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.

Proper citation: RRID:Addgene_46909 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X