Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: CYTB-W77-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198848 Copy
Species: Rattus norvegicus
Genetic Insert: COX3-W16-L17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198846 Copy
Species: Rattus norvegicus
Genetic Insert: ND5-W68-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198858 Copy
Species: Rattus norvegicus
Genetic Insert: ND3-Q26-L18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198854 Copy
Species: Rattus norvegicus
Genetic Insert: ND2-W30-L16 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198852 Copy
Species: Rattus norvegicus
Genetic Insert: ND1-W86-L14 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198850 Copy
Species: Rattus norvegicus
Genetic Insert: Lamp1
Vector Backbone Description: Vector Backbone:pLJM1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36007018
Proper citation: RRID:Addgene_199750 Copy
Species: Rattus norvegicus
Genetic Insert: Gephyrin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPC2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36314779
Comments: Gephyrin C4a cassette encodes ARLPSCSSTYSVSE after K288 (expressed in neurons and promotes oligomerization of gephyrin molecules for synapse scaffolding. Inhibitory synapse distribution for C4a and P1 variant of gephyrin currently unknown)
Proper citation: RRID:Addgene_199611 Copy
Species: Rattus norvegicus
Genetic Insert: ND6-W82-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198861 Copy
Species: Rattus norvegicus
Genetic Insert: Gephyrin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPC2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23408424
Proper citation: RRID:Addgene_199608 Copy
Species: Rattus norvegicus
Genetic Insert: COX3-W16-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198847 Copy
Species: Rattus norvegicus
Genetic Insert: COX1-W25-R18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198843 Copy
Species: Rattus norvegicus
Genetic Insert: ND5-W68-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198859 Copy
Species: Rattus norvegicus
Genetic Insert: ND3-Q26-R19 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198855 Copy
Species: Rattus norvegicus
Genetic Insert: ND2-W30-R18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198853 Copy
Species: Rattus norvegicus
Genetic Insert: mGluR5a
Vector Backbone Description: Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-mGluR1/5 (Group I) glutamate receptor [N75/33R].
Proper citation: RRID:Addgene_197305 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The first codon of the Synpatotagmin has been removed.
Proper citation: RRID:Addgene_184502 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 17
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed
Proper citation: RRID:Addgene_184514 Copy
Species: Rattus norvegicus
Genetic Insert: PACT-mOrange2-hCM1
Vector Backbone Description: Backbone Size:6972; Vector Backbone:pBeta-actin-Nedd1-mOrange2-hCM1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Proper citation: RRID:Addgene_196868 Copy
Species: Rattus norvegicus
Genetic Insert: Akap9
Vector Backbone Description: Backbone Size:3519; Vector Backbone:pCR-XL-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36796357
Comments: For successful transformation of Plasmid 196867: pCR-XL-rAkap9, it is recommended to use electroporation and to grow transformed bacteria at no more than 28 °C for two days and with 30 μg/ml kanamycin on LB plates for full length plasmid production
Proper citation: RRID:Addgene_196867 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
