Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: FAST-PETase
Vector Backbone Description: Vector Backbone:pBTK522; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35478237
Proper citation: RRID:Addgene_214754 Copy
Species: Synthetic
Genetic Insert: 6x clustered CRE element with barcode 0484
Vector Backbone Description: Vector Backbone:pGL4; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635397
Proper citation: RRID:Addgene_214637 Copy
Genetic Insert: Firefly luciferase
Vector Backbone Description: Vector Backbone:pRD_RIPE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38375914
Comments: Please visit https://doi.org/10.1101/2023.11.14.567061 for bioRxiv preprint.
Proper citation: RRID:Addgene_214075 Copy
Species: Synthetic
Genetic Insert: U6p::GTCCAGCGGCAGATCGGCGG
Vector Backbone Description: Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215683 Copy
Species: Homo sapiens
Genetic Insert: SOX10, Olig2, NKX6.2
Vector Backbone Description: Backbone Size:7812; Vector Backbone:pRRL.SF-IRES-Pac; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28246330
Proper citation: RRID:Addgene_214402 Copy
Species: Homo sapiens
Genetic Insert: SOX10, Olig2, NKX6.2
Vector Backbone Description: Backbone Size:7812; Vector Backbone:pRRL.SF-IRES-Pac; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28246330
Proper citation: RRID:Addgene_214403 Copy
Species: Zonotrichia albicollis
Genetic Insert: R2 retroelement protein
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38379101
Proper citation: RRID:Addgene_216548 Copy
Species: Lassa virus - Josiah strain
Genetic Insert: LASV GP-HA-FLAG
Vector Backbone Description: Backbone Size:6205; Vector Backbone:pcDNAintron; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30587764
Comments: codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles.
Proper citation: RRID:Addgene_215691 Copy
Species: Homo sapiens
Genetic Insert: CRBN
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7280; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39406745
Comments: Please visit https://doi.org/10.1101/2024.01.17.575503 for bioRxiv preprint.
Proper citation: RRID:Addgene_215330 Copy
Species: Homo sapiens
Genetic Insert: HOXB1 AroLITE A
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215590 Copy
Species: Homo sapiens
Genetic Insert: HOXC6
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_153693,ENST00000394331 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142283 Copy
Species: Homo sapiens
Genetic Insert: MYOD1 AroPERFECT C
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215621 Copy
Species: Homo sapiens
Genetic Insert: MYOD1 AroPERFECT
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215620 Copy
Species: Homo sapiens
Genetic Insert: XRCC5
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_021141,ENST00000392133,ENST00000392132 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142291 Copy
Species: Homo sapiens
Genetic Insert: S6Y AroPATCHY1
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215633 Copy
Species: Homo sapiens
Genetic Insert: CASP4
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37993712
Proper citation: RRID:Addgene_214308 Copy
Species: Homo sapiens
Genetic Insert: PAX3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_181460,ENST00000336840 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142346 Copy
Species: Homo sapiens
Genetic Insert: DDX3X
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216581 Copy
Species: Homo sapiens
Genetic Insert: DDX3X
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216580 Copy
Species: Homo sapiens
Genetic Insert: DDX3X
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216579 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
