Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: RPL18Bp-TOM70-Link-Neon(gfp)
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning
Proper citation: RRID:Addgene_179050 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RPL18Bp-Scarlet(rfp)-Link-SCS2tmh
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning
Proper citation: RRID:Addgene_179056 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TDH3p-Scarlet(rfp)-Link-SCS2tmh
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning
Proper citation: RRID:Addgene_179076 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TDH3p-Neon(gfp)-Link-SCS2tmh
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning
Proper citation: RRID:Addgene_179075 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mito-yHS1-M7A
Vector Backbone Description: Backbone Marker:M. Funk; Backbone Size:6900; Vector Backbone:p415GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32265272
Comments: The first-generation heme sensor, HS1, consists of a heme-binding domain, the His/Met coordinating 4-alpha-helical bundle hemoprotein cytochrome b562 (Cyt b562) (13), fused to a pair of fluorescent proteins, EGFP and Katushka 2 (mKATE2)
Proper citation: RRID:Addgene_159164 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: DDP1
Vector Backbone Description: Vector Backbone:p416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35862758
Proper citation: RRID:Addgene_183950 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TAF14
Vector Backbone Description: Backbone Size:5741; Vector Backbone:YEplac181; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15082542
Proper citation: RRID:Addgene_8625 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL11
Vector Backbone Description: Backbone Size:5741; Vector Backbone:YEplac181; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15082542
Proper citation: RRID:Addgene_8628 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SOH1
Vector Backbone Description: Backbone Size:5741; Vector Backbone:YEplac181; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15082542
Proper citation: RRID:Addgene_8623 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NOP1pr-GFP11-mCherry-Scs2TM
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86416 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NOP1pr-GFP11-PUS1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86414 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GFP1-10
Vector Backbone Description: Backbone Size:8200; Vector Backbone:pFA6-link-CaURA3MX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Comments: for C-terminal PCR tagging with GFP1-10
Proper citation: RRID:Addgene_86419 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NOP1pr-mCherry-SCS2TM-GFP11
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86417 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NOP1pr-GFP1-10-Scs2TM
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86418 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC42pr-GFP1-10
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86420 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC42pr-KAR2SS-GFP1-10
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86421 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VMA intein
Vector Backbone Description: Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28186733
Comments: TGTCCTACTCAGGAGAGCGTTCAC to sequence VMA C-term; and ACCCATGACCTTATTACCAACCTC to sequence the insert between MBP C-term and VMA
Proper citation: RRID:Addgene_86590 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1 upstream of HIS3
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC119; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10793159
Comments: UB1 fragment (SphI-SacI) from pRB306 inserted into SphI-SacI-cut polylinker of pUC119. Then, SalI-KpnI (partial) fragment from pJJ217 containing the entire HIS3 gene and flanking regions, inserted into XhoI-KpnI vector fragment; HIS3 is in the same orientation that TUB1 was; note that this disruption construct removes the first 763 bp of the 1580-bp ORF downstream of TUB1 (YML086c). For information on pUC119, search for pUC119 in Addgene's vector db.
Proper citation: RRID:Addgene_8670 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1
Vector Backbone Description: Backbone Marker:Botstein et al. Gene. 1979 8(1):17-24.; Backbone Size:0; Vector Backbone:YEp21; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3540600
Comments: A TUB1 fragment was ligated from the SphI site (1.1 kilobases before the start codon) to a BglII site (0.5 kb beyond the stop codon) in place of the small SphI-to-BamHI (??) fragment of YEp21. For more information on YEp21, search for YEp21 in Addgene's vector db.
Proper citation: RRID:Addgene_8668 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1-D252A under GAL1 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS210; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739794
Comments: PCRed TUB1-D252A products were digested with BamHI and SpeI and ligated to the BamHI and XbaI sites of pTS210. The vector plasmid pTS210, a YCp50-based construct, contained the GAL1/GAL10 promoter, a short polylinker (BamHI, HindIII, XbaI), and the ACT1 transcriptional terminator.
Proper citation: RRID:Addgene_8673 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
