Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:PTAL6; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25204665
Proper citation: RRID:Addgene_60671 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yemGFP
Vector Backbone Description: Backbone Size:2192; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25035932
Proper citation: RRID:Addgene_60778 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_60816 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:3532; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25035932
Comments: Discrepancies between full and QC sequences have no functional consequence.
Proper citation: RRID:Addgene_60780 Copy
Species: streptococcus pyogenes
Genetic Insert: S. pyogenese Cas9
Vector Backbone Description: Vector Backbone:2-micron/pUC; Vector Types:Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25139909
Proper citation: RRID:Addgene_60847 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654
Proper citation: RRID:Addgene_60734 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654
Proper citation: RRID:Addgene_60733 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654
Proper citation: RRID:Addgene_60737 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654
Proper citation: RRID:Addgene_60740 Copy
Species: Branchiostoma floridae (amphioxus)
Genetic Insert: GFPc1
Vector Backbone Description: Backbone Size:5260; Vector Backbone:pHIS8; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24968921
Proper citation: RRID:Addgene_60750 Copy
Species: Rattus norvegicus
Genetic Insert: Agouti signaling protein gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets a 19-bp deletion in exon 2 of the Agouti signalling protein (Asip) gene
Proper citation: RRID:Addgene_60968 Copy
Species: Rattus norvegicus
Genetic Insert: Tyrosinase gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets a mutation 896G>A in exon 2 of the Tyr gene resulting in an Arg299His missense mutation
Proper citation: RRID:Addgene_60967 Copy
Species: Rattus norvegicus
Genetic Insert: v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets an integrated 7,098-bp endogenous retroviral element (ERV) within the first intron of the Kit gene
Proper citation: RRID:Addgene_60970 Copy
Species: Ruminococcus flavefaciens
Genetic Insert: CohIII
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25482395
Proper citation: RRID:Addgene_60866 Copy
Species: Synthetic
Genetic Insert: Xyl
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4304; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25482395
Proper citation: RRID:Addgene_60865 Copy
Species: Synthetic
Genetic Insert: EGFP sgRNA
Vector Backbone Description: Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24179142
Comments: eGFP sgRNA = GGCGAGGGCGATGCCACCTA
Proper citation: RRID:Addgene_61051 Copy
Genetic Insert: α-actinin-stFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18479457
Proper citation: RRID:Addgene_61104 Copy
Genetic Insert: spectrin-cpstFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22389408
Proper citation: RRID:Addgene_61111 Copy
Species: Homo sapiens
Genetic Insert: SENP2M497A catalytic domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23955022
Proper citation: RRID:Addgene_61088 Copy
Species: Cricetulus griseus
Genetic Insert: pkac2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12574406
Comments: The Y307H found in Addgene's QC sequence has no known functional consequence.
Proper citation: RRID:Addgene_61092 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
