Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 62 showing 1221 ~ 1240 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_60671

http://www.addgene.org/60671

Vector Backbone Description: Vector Backbone:PTAL6; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25204665

Proper citation: RRID:Addgene_60671 Copy   


  • RRID:Addgene_60778

http://www.addgene.org/60778

Species: Saccharomyces cerevisiae
Genetic Insert: yemGFP
Vector Backbone Description: Backbone Size:2192; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25035932

Proper citation: RRID:Addgene_60778 Copy   


  • RRID:Addgene_60816

http://www.addgene.org/60816

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_60816 Copy   


http://www.addgene.org/60780

Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:3532; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25035932
Comments: Discrepancies between full and QC sequences have no functional consequence.

Proper citation: RRID:Addgene_60780 Copy   


  • RRID:Addgene_60847

    This resource has 10+ mentions.

http://www.addgene.org/60847

Species: streptococcus pyogenes
Genetic Insert: S. pyogenese Cas9
Vector Backbone Description: Vector Backbone:2-micron/pUC; Vector Types:Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25139909

Proper citation: RRID:Addgene_60847 Copy   


  • RRID:Addgene_60734

http://www.addgene.org/60734

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654

Proper citation: RRID:Addgene_60734 Copy   


  • RRID:Addgene_60733

    This resource has 1+ mentions.

http://www.addgene.org/60733

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654

Proper citation: RRID:Addgene_60733 Copy   


  • RRID:Addgene_60737

http://www.addgene.org/60737

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654

Proper citation: RRID:Addgene_60737 Copy   


  • RRID:Addgene_60740

http://www.addgene.org/60740

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23479654

Proper citation: RRID:Addgene_60740 Copy   


  • RRID:Addgene_60750

http://www.addgene.org/60750

Species: Branchiostoma floridae (amphioxus)
Genetic Insert: GFPc1
Vector Backbone Description: Backbone Size:5260; Vector Backbone:pHIS8; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24968921

Proper citation: RRID:Addgene_60750 Copy   


  • RRID:Addgene_60968

http://www.addgene.org/60968

Species: Rattus norvegicus
Genetic Insert: Agouti signaling protein gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets a 19-bp deletion in exon 2 of the Agouti signalling protein (Asip) gene

Proper citation: RRID:Addgene_60968 Copy   


  • RRID:Addgene_60967

http://www.addgene.org/60967

Species: Rattus norvegicus
Genetic Insert: Tyrosinase gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets a mutation 896G>A in exon 2 of the Tyr gene resulting in an Arg299His missense mutation

Proper citation: RRID:Addgene_60967 Copy   


  • RRID:Addgene_60970

http://www.addgene.org/60970

Species: Rattus norvegicus
Genetic Insert: v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA
Vector Backbone Description: Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24967838
Comments: Targets an integrated 7,098-bp endogenous retroviral element (ERV) within the first intron of the Kit gene

Proper citation: RRID:Addgene_60970 Copy   


http://www.addgene.org/60866

Species: Ruminococcus flavefaciens
Genetic Insert: CohIII
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25482395

Proper citation: RRID:Addgene_60866 Copy   


http://www.addgene.org/60865

Species: Synthetic
Genetic Insert: Xyl
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4304; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25482395

Proper citation: RRID:Addgene_60865 Copy   


  • RRID:Addgene_61051

    This resource has 1+ mentions.

http://www.addgene.org/61051

Species: Synthetic
Genetic Insert: EGFP sgRNA
Vector Backbone Description: Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24179142
Comments: eGFP sgRNA = GGCGAGGGCGATGCCACCTA

Proper citation: RRID:Addgene_61051 Copy   


  • RRID:Addgene_61104

http://www.addgene.org/61104

Genetic Insert: α-actinin-stFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18479457

Proper citation: RRID:Addgene_61104 Copy   


  • RRID:Addgene_61111

http://www.addgene.org/61111

Genetic Insert: spectrin-cpstFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22389408

Proper citation: RRID:Addgene_61111 Copy   


  • RRID:Addgene_61088

http://www.addgene.org/61088

Species: Homo sapiens
Genetic Insert: SENP2M497A catalytic domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23955022

Proper citation: RRID:Addgene_61088 Copy   


  • RRID:Addgene_61092

http://www.addgene.org/61092

Species: Cricetulus griseus
Genetic Insert: pkac2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12574406
Comments: The Y307H found in Addgene's QC sequence has no known functional consequence.

Proper citation: RRID:Addgene_61092 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X