Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,857 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
PTAL10
 
Resource Report
Resource Website 		RRID:Addgene_60671 Kanamycin PMID:25204665 Vector Backbone:PTAL6; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:34 0
pZA2[PLac:GFP]
 
Resource Report
Resource Website 		RRID:Addgene_60778 yemGFP Saccharomyces cerevisiae Kanamycin PMID:25035932 Backbone Size:2192; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:36 0
pCri-1a
 
Resource Report
Resource Website 		RRID:Addgene_60816 Green fluorescent protein Kanamycin PMID:25386923 Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:36 0
pZA2[PLac:mCherry,PTAN:GFP]
 
Resource Report
Resource Website 		RRID:Addgene_60780 mCherry Kanamycin PMID:25035932 Discrepancies between full and QC sequences have no functional consequence. Backbone Size:3532; Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:17:36 0
pCAS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60847 S. pyogenese Cas9 streptococcus pyogenes Kanamycin PMID:25139909 Vector Backbone:2-micron/pUC; Vector Types:Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:37 32
pET:GACT:GFP
 
Resource Report
Resource Website 		RRID:Addgene_60734 GFP Kanamycin PMID:23479654 Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:35 0
pET28:GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60733 GFP Kanamycin PMID:23479654 Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:35 6
pET:CACT:GFP
 
Resource Report
Resource Website 		RRID:Addgene_60737 GFP Kanamycin PMID:23479654 Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:35 0
pET:ACAT:GFP
 
Resource Report
Resource Website 		RRID:Addgene_60740 GFP Kanamycin PMID:23479654 Backbone Size:5273; Vector Backbone:pET-28b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:35 0
bfloGFPc1a
 
Resource Report
Resource Website 		RRID:Addgene_60750 GFPc1 Branchiostoma floridae (amphioxus) Kanamycin PMID:24968921 Backbone Size:5260; Vector Backbone:pHIS8; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:35 0
pT7-gRNA:Asip
 
Resource Report
Resource Website 		RRID:Addgene_60968 Agouti signaling protein gRNA Rattus norvegicus Kanamycin PMID:24967838 Targets a 19-bp deletion in exon 2 of the Agouti signalling protein (Asip) gene Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:37 0
pT7-gRNA:Tyr (wild)
 
Resource Report
Resource Website 		RRID:Addgene_60967 Tyrosinase gRNA Rattus norvegicus Kanamycin PMID:24967838 Targets a mutation 896G>A in exon 2 of the Tyr gene resulting in an Arg299His missense mutation Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:37 0
pT7-gRNA:kit-2-1
 
Resource Report
Resource Website 		RRID:Addgene_60970 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA Rattus norvegicus Kanamycin PMID:24967838 Targets an integrated 7,098-bp endogenous retroviral element (ERV) within the first intron of the Kit gene Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:37 0
pET28a-CohIII-CBM-HIS-ybbR
 
Resource Report
Resource Website 		RRID:Addgene_60866 CohIII Ruminococcus flavefaciens Kanamycin PMID:25482395 Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:36 0
pET28a-HIS-Xyl-Xmod-DocIII
 
Resource Report
Resource Website 		RRID:Addgene_60865 Xyl Synthetic Kanamycin PMID:25482395 Backbone Marker:Novagen; Backbone Size:4304; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Threonine 120 to Cysteine in Xylanase domain 2026-08-15 01:17:36 0
DR274-eGFP sgRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61051 EGFP sgRNA Synthetic Kanamycin PMID:24179142 eGFP sgRNA = GGCGAGGGCGATGCCACCTA Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:38 3
Actinin-C-stFRET
 
Resource Report
Resource Website 		RRID:Addgene_61104 α-actinin-stFRET Kanamycin PMID:18479457 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:39 0
Spectrin-C-cpstFRET
 
Resource Report
Resource Website 		RRID:Addgene_61111 spectrin-cpstFRET Kanamycin PMID:22389408 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:39 0
SENP2M497A
 
Resource Report
Resource Website 		RRID:Addgene_61088 SENP2M497A catalytic domain Homo sapiens Kanamycin PMID:23955022 Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin M497A; Catalytic domain is residues 364-589 2026-08-15 01:17:38 0
GPKAnes
 
Resource Report
Resource Website 		RRID:Addgene_61092 pkac2 Cricetulus griseus Kanamycin PMID:12574406 The Y307H found in Addgene's QC sequence has no known functional consequence. Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch