Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBTK522-FAST-PETase
 
Resource Report
Resource Website 		RRID:Addgene_214754 FAST-PETase Kanamycin PMID:35478237 Vector Backbone:pBTK522; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:52 0
pGL4_CRE-CMV-BC0484-luc2
 
Resource Report
Resource Website 		RRID:Addgene_214637 6x clustered CRE element with barcode 0484 Synthetic Ampicillin PMID:38635397 Vector Backbone:pGL4; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:52 0
LiRT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_214075 Firefly luciferase Ampicillin PMID:38375914 Please visit https://doi.org/10.1101/2023.11.14.567061 for bioRxiv preprint. Vector Backbone:pRD_RIPE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Linker sequence present between firefly luciferase and GFP Addgene 2026-10-10 02:06:53 1
pMS161
 
Resource Report
Resource Website 		RRID:Addgene_215683 U6p::GTCCAGCGGCAGATCGGCGG Synthetic Ampicillin PMID:38351905 Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
SF-SON IRES Puro
 
Resource Report
Resource Website 		RRID:Addgene_214402 SOX10, Olig2, NKX6.2 Homo sapiens Ampicillin PMID:28246330 Backbone Size:7812; Vector Backbone:pRRL.SF-IRES-Pac; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
SF-SON IRES Tomato
 
Resource Report
Resource Website 		RRID:Addgene_214403 SOX10, Olig2, NKX6.2 Homo sapiens Ampicillin PMID:28246330 Backbone Size:7812; Vector Backbone:pRRL.SF-IRES-Pac; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
pcDNA3.1 ZoAl-ENT N-1F (R1103A)
 
Resource Report
Resource Website 		RRID:Addgene_216548 R2 retroelement protein Zonotrichia albicollis Ampicillin PMID:38379101 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
pcDNAintron-LASV-GPC-HA-c3xFLAG
 
Resource Report
Resource Website 		RRID:Addgene_215691 LASV GP-HA-FLAG Lassa virus - Josiah strain Ampicillin PMID:30587764 codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles. Backbone Size:6205; Vector Backbone:pcDNAintron; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
His6-TEV-CRBN-midi
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_215330 CRBN Homo sapiens Kanamycin PMID:39406745 Please visit https://doi.org/10.1101/2024.01.17.575503 for bioRxiv preprint. Backbone Marker:Novagen; Backbone Size:7280; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contains amino acids 41-187 followed by a Gly-Ser-Gly linker and amino acids 249-426, with mutations C78I, I92V, K116N, Q134E, R283W, C287N, V293S, G302D, L342R, C343E, T359I and L423I Addgene 2026-10-10 02:06:53 4
pGAL4-DBD-HOXB1-AroLITE_A
 
Resource Report
Resource Website 		RRID:Addgene_215590 HOXB1 AroLITE A Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
TFORF0638
 
Resource Report
Resource Website 		RRID:Addgene_142283 HOXC6 Homo sapiens Ampicillin PMID:36608654 NM_153693,ENST00000394331 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pPB-TetON-mEGFP-MYOD1_AroPERFECT-C
 
Resource Report
Resource Website 		RRID:Addgene_215621 MYOD1 AroPERFECT C Homo sapiens Ampicillin PMID:38969762 Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pPB-TetON-mEGFP-MYOD1_AroPERFECT
 
Resource Report
Resource Website 		RRID:Addgene_215620 MYOD1 AroPERFECT Homo sapiens Ampicillin PMID:38969762 Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
TFORF1928
 
Resource Report
Resource Website 		RRID:Addgene_142291 XRCC5 Homo sapiens Ampicillin PMID:36608654 NM_021141,ENST00000392133,ENST00000392132 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
pGAL4-DBD-S6Y_AroPATCHY1
 
Resource Report
Resource Website 		RRID:Addgene_215633 S6Y AroPATCHY1 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pET16_Caspase-4_p10
 
Resource Report
Resource Website 		RRID:Addgene_214308 CASP4 Homo sapiens Ampicillin PMID:37993712 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:53 0
TFORF2647
 
Resource Report
Resource Website 		RRID:Addgene_142346 PAX3 Homo sapiens Ampicillin PMID:36608654 NM_181460,ENST00000336840 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:55 0
DDX3X - A393T in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216581 DDX3X Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin A393T Addgene 2026-10-10 02:06:54 0
DDX3X - E388G in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216580 DDX3X Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin E388G Addgene 2026-10-10 02:06:54 0
DDX3X - P324Q in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216579 DDX3X Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin P324Q Addgene 2026-10-10 02:06:54 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch