Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-Ef1a-FAS-ChETA-TdTomato-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37089 | ChETA-TdTomato | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 1 | ||
|
pAAV-Ef1a-DIO-EGFP-WPRE-pA Resource Report Resource Website 10+ mentions |
RRID:Addgene_37084 | EGFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 17 | ||
|
pAAV-Ef1a-DO-EGFP-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37085 | EGFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 5 | ||
|
pAAV-Ef1a-DO-NpHR3.0-eYFP-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37087 | NpHR3.0-EYFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 3 | ||
|
pAAV-Ef1a-FAS-EGFP-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37091 | d1eGFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 1 | ||
|
pAAV-Ef1a-FAS-TdTomato-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37092 | TdTomato | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5435; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 4 | ||
|
pcDWUER Resource Report Resource Website 1+ mentions |
RRID:Addgene_37094 | WU polyomavirus early region | WU polyomavirus | Ampicillin | PMID:17480120 | Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 2 | ||
|
mMib1-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_37116 | Mib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1)) | Mus musculus | Kanamycin | PMID:21903422 | Backbone Marker:Agilent (Stratagene); Backbone Size:4319; Vector Backbone:pCMV-Tag4a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | ACC Kozak sequence added before ATG annotated. | 2026-08-15 01:14:12 | 3 | |
|
UAS::PTPRFa.1-DN-GFP Resource Report Resource Website |
RRID:Addgene_37110 | UAS::PTPRFa.1-DN-GFP | Danio rerio | Ampicillin | PMID:22326027 | PTPRFa sequence ends at aa1326 and is followed by the short sequence NPAFLYKVAT immediately before EGFP. | Backbone Marker:Chi-Bien Chien; Backbone Size:5883; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 Gateway Expression Vector; Bacterial Resistance:Ampicillin | deleted amino acids 1326-1894 | 2026-08-15 01:14:12 | 0 |
|
UAS::PTPRDb-DN-GFP Resource Report Resource Website |
RRID:Addgene_37112 | UAS::PTPRDb-DN-GFP | Danio rerio | Ampicillin | PMID:22326027 | Backbone Marker:Chi-Bien Chien; Backbone Size:5883; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 Gateway Destination Vector; Bacterial Resistance:Ampicillin | deleted cytodomain, including phosphatase domains (aa 959-1516) | 2026-08-15 01:14:12 | 0 | |
|
pCMV-GLI(-)TAD Resource Report Resource Website |
RRID:Addgene_37113 | GLI1 | Homo sapiens | Ampicillin | PMID:9452474 | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted 1,409 bp AccI fragment from 3' end of GLI cDNA | 2026-08-15 01:14:12 | 0 | |
|
Lenti-Hb9-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_37080 | Hb9 GFP | Mus musculus | Ampicillin | PMID:19041781 | Expresses GFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons | Backbone Marker:Inder Verma lab; Backbone Size:8466; Vector Backbone:CSCspPW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 6 | |
|
pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37082 | hChr2(H134R)-mCherry | Synthetic | Ampicillin | PMID:22660328 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 7 | ||
|
pAAV-Ef1a-DIO-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37083 | mCherry | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 6 | ||
|
pET15b-eIF4E Resource Report Resource Website |
RRID:Addgene_37228 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET15b-eIF4E-S200C Resource Report Resource Website |
RRID:Addgene_37229 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S200C | 2026-08-15 01:14:13 | 0 | |
|
pCMV-Tag2B EDD Resource Report Resource Website 10+ mentions |
RRID:Addgene_37188 | EDD | Homo sapiens | Kanamycin | PMID:12011095 | Addgene NGS results identified a K503R mutation within the UBR5 translation. There is no information on the functional consequence of this mutation | Backbone Marker:Stratagene; Backbone Size:4373; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Please see Depositor Comments | 2026-08-15 01:14:13 | 15 |
|
pMGAHisTev5B Resource Report Resource Website |
RRID:Addgene_37221 | eIF5B | Saccharomyces cerevisiae | Kanamycin | PMID:17913637 | Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin | N-term truncation (contains aa 396-1002) | 2026-08-15 01:14:13 | 0 | |
|
pUC19-HHtRNA Resource Report Resource Website |
RRID:Addgene_37222 | HHtRNA | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
pET PPL His6 MBP LIC cloning vector (2K-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37183 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. 2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
