Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 63 showing 1241 ~ 1260 out of 33,857 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_61156

http://www.addgene.org/61156

Species: Escherichia coli
Genetic Insert: gusA
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10404164
Comments: Matsumura lab strain number 337

Proper citation: RRID:Addgene_61156 Copy   

http://www.addgene.org/61294

Species: Rattus norvegicus
Genetic Insert: alpha SSeCKS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_61294 Copy   

http://www.addgene.org/61237

Species: Homo sapiens
Genetic Insert: DIXDC1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61237 Copy   

http://www.addgene.org/61235

Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61235 Copy   

    • RRID:Addgene_61234

http://www.addgene.org/61234

Species: Homo sapiens
Genetic Insert: shLkb1 (Ms/Hu)
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61234 Copy   

    • RRID:Addgene_61243

http://www.addgene.org/61243

Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61243 Copy   

    • RRID:Addgene_61253

    This resource has 1+ mentions.

http://www.addgene.org/61253

Species: Caenorhabditis elegans
Genetic Insert: U6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25491644

Proper citation: RRID:Addgene_61253 Copy   

    • RRID:Addgene_61264

    This resource has 1+ mentions.

http://www.addgene.org/61264

Genetic Insert: Ptac-dTomato
Vector Backbone Description: Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: dTomato reference: Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037

Proper citation: RRID:Addgene_61264 Copy   

    • RRID:Addgene_61263

    This resource has 1+ mentions.

http://www.addgene.org/61263

Vector Backbone Description: Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA

Proper citation: RRID:Addgene_61263 Copy   

    • RRID:Addgene_61335

http://www.addgene.org/61335

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61335 Copy   

    • RRID:Addgene_61333

http://www.addgene.org/61333

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61333 Copy   

    • RRID:Addgene_61341

http://www.addgene.org/61341

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61341 Copy   

    • RRID:Addgene_61340

http://www.addgene.org/61340

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61340 Copy   

    • RRID:Addgene_61403

    This resource has 10+ mentions.

http://www.addgene.org/61403

Vector Backbone Description: Backbone Size:6911; Vector Backbone:pNeuroD-Ires-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19737524

Proper citation: RRID:Addgene_61403 Copy   

    • RRID:Addgene_61404

    This resource has 1+ mentions.

http://www.addgene.org/61404

Species: Homo sapiens
Genetic Insert: KCC2
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pCITF; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19376067

Proper citation: RRID:Addgene_61404 Copy   

http://www.addgene.org/61405

Species: Homo sapiens
Genetic Insert: OTUD1
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681

Proper citation: RRID:Addgene_61405 Copy   

http://www.addgene.org/61406

Species: Homo sapiens
Genetic Insert: OTUD1
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681
Comments: Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018

Proper citation: RRID:Addgene_61406 Copy   

http://www.addgene.org/61409

Species: Homo sapiens
Genetic Insert: OTUD2
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681
Comments: Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018

Proper citation: RRID:Addgene_61409 Copy   

http://www.addgene.org/61414

Species: Homo sapiens
Genetic Insert: ALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13)
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681

Proper citation: RRID:Addgene_61414 Copy   

    • RRID:Addgene_61378

http://www.addgene.org/61378

Genetic Insert: QS
Vector Backbone Description: Backbone Marker:Life Technologies ; Backbone Size:2555; Vector Backbone:pDONR221; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23792917
Comments: Discrepancies between full sequence and Addgene's QC results have no functional consequence.

Proper citation: RRID:Addgene_61378 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch