Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: beta2-adrenergic receptor
Vector Backbone Description: Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23629648
Comments: Notes:
(1) The pCDNA/FRT vector contains an extra XbaI site.
(2) The XbaI restriction enzyme is sensitive to dam methylation.
Proper citation: RRID:Addgene_47438 Copy
Species: Homo sapiens
Genetic Insert: Intersectin short
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11584276
Proper citation: RRID:Addgene_47392 Copy
Species: Homo sapiens
Genetic Insert: intersectin long
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11584276
Proper citation: RRID:Addgene_47395 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
gRNA target sequence atatcagtctgtttcgtaa
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47550 Copy
Species: Mus musculus
Genetic Insert: Nanog
Vector Backbone Description: Vector Backbone:pCR2.1TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23992847
Proper citation: RRID:Addgene_48680 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48677 Copy
Species: Homo sapiens
Genetic Insert: YWHAZ
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12757707
Proper citation: RRID:Addgene_48798 Copy
Species: N. meningitidis
Genetic Insert: Cas9-VP64, nuclease-null
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48676 Copy
Species: Homo sapiens
Genetic Insert: YWHAE 14-3-3 ϵ
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12757707
Proper citation: RRID:Addgene_48797 Copy
Species: N. meningitidis
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 hygro; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48670 Copy
Species: S. pyogenes
Genetic Insert: Cas9-VP64, nuclease-null
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48674 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48672 Copy
Species: Mus musculus
Genetic Insert: RORb
Vector Backbone Description: Vector Backbone:CBIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Please note that Addgene's sequencing results identified a few differences in the vector backbone when compared to the full plasmid sequence from the depositing laboratory. According to the depositor, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48709 Copy
Species: S. thermophilus #1
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48669 Copy
Species: Synthetic
Genetic Insert: 8xLexA-binding elements
Vector Backbone Description: Backbone Marker:Takara Bio; Backbone Size:2736; Vector Backbone:pMD20; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22043306
Proper citation: RRID:Addgene_48807 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23888043
Proper citation: RRID:Addgene_48805 Copy
Species: Homo sapiens
Genetic Insert: AQP9
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17346701
Proper citation: RRID:Addgene_48808 Copy
Species: Synthetic
Genetic Insert: Cre::ERT2
Vector Backbone Description: Backbone Size:6100; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23582324
Proper citation: RRID:Addgene_48760 Copy
Vector Backbone Description: Backbone Marker:GeneArt; Vector Backbone:pMS; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24048591
Proper citation: RRID:Addgene_48876 Copy
Genetic Insert: cmlc2::attP-EGFP
Vector Backbone Description: Backbone Marker:GeneArt; Vector Backbone:pMA; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24048591
Proper citation: RRID:Addgene_48875 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
