Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: GFP-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
Proper citation: RRID:Addgene_66823 Copy
Species: Caenorhabditis elegans
Genetic Insert: C.elegans YAP-1
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Comments: I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine.
Proper citation: RRID:Addgene_66857 Copy
Species: Caenorhabditis elegans
Genetic Insert: EGL-44
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66855 Copy
Species: Caenorhabditis elegans
Genetic Insert: WTS-1
Vector Backbone Description: Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66856 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26712014
Proper citation: RRID:Addgene_68120 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69156 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:7517; Vector Backbone:pCFJ350; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Comments: discrepancies between QC and full sequence should not have functional consequences
Proper citation: RRID:Addgene_69155 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:7606; Vector Backbone:pCFJ356; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Comments: discrepancies between QC and full sequence should not have functional consequences
Proper citation: RRID:Addgene_69154 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:7517; Vector Backbone:pCFJ350; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69152 Copy
Species: Caenorhabditis elegans
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:7606; Vector Backbone:pCFJ356; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_69151 Copy
Species: Caenorhabditis elegans
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69255 Copy
Species: Caenorhabditis elegans
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69254 Copy
Species: Caenorhabditis elegans
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69253 Copy
Species: Caenorhabditis elegans
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69258 Copy
Species: Caenorhabditis elegans
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26144318
Proper citation: RRID:Addgene_69256 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTurquoise2-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37351566
Comments: pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites.
Proper citation: RRID:Addgene_73343 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::GFP + SEC
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34903234
Comments: pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites.
Proper citation: RRID:Addgene_73344 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-70::TSMod
Vector Backbone Description: Vector Backbone:pEXPR; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24561618
Proper citation: RRID:Addgene_73367 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::mKate2::PH::tbb-2
Vector Backbone Description: Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27385332
Proper citation: RRID:Addgene_73512 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::mCherryo::PH::tbb-2
Vector Backbone Description: Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27385332
Proper citation: RRID:Addgene_73511 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
