Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDD282 Resource Report Resource Website 50+ mentions |
RRID:Addgene_66823 | GFP-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat] | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:32 | 51 | |
|
pPD95.75-cYAP-1 Resource Report Resource Website |
RRID:Addgene_66857 | C.elegans YAP-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine. | Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Serine104 is mutated to alanine | 2026-08-15 01:18:33 | 0 |
|
pClneoMyc'-EGL-44 Resource Report Resource Website |
RRID:Addgene_66855 | EGL-44 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:30 | 0 | ||
|
pFLAG-WTS-1 Resource Report Resource Website |
RRID:Addgene_66856 | WTS-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E153G and D871G mutations in WTS1 compared to GenBank reference sequence NP_492699.1 | 2026-08-15 01:18:30 | 0 | |
|
Prab-3::NLS::GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_68120 | GFP | Caenorhabditis elegans | Ampicillin | PMID:26712014 | Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:44 | 1 | ||
|
pSR21 Resource Report Resource Website |
RRID:Addgene_69156 | mCherry | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:50 | 0 | |
|
pSR13 Resource Report Resource Website |
RRID:Addgene_69155 | mCherry | Caenorhabditis elegans | Ampicillin | PMID:26144318 | discrepancies between QC and full sequence should not have functional consequences | Backbone Marker:Erik Jorgensen; Backbone Size:7517; Vector Backbone:pCFJ350; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:50 | 0 |
|
pSR11 Resource Report Resource Website |
RRID:Addgene_69154 | mCherry | Caenorhabditis elegans | Ampicillin | PMID:26144318 | discrepancies between QC and full sequence should not have functional consequences | Backbone Marker:Erik Jorgensen; Backbone Size:7606; Vector Backbone:pCFJ356; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:55 | 0 |
|
pSR06 Resource Report Resource Website |
RRID:Addgene_69152 | mCherry | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:7517; Vector Backbone:pCFJ350; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:50 | 0 | |
|
pSR04 Resource Report Resource Website |
RRID:Addgene_69151 | mCherry | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Erik Jorgensen; Backbone Size:7606; Vector Backbone:pCFJ356; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:50 | 0 |
|
pSR29 Resource Report Resource Website |
RRID:Addgene_69255 | Cre recombinase | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0, tbb-2 UTR is in wrong orientation but this does not affect expression levels | 2026-08-15 01:18:51 | 0 | |
|
pSR33 Resource Report Resource Website |
RRID:Addgene_69254 | Cre recombinase | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:51 | 0 | |
|
pSR28 Resource Report Resource Website |
RRID:Addgene_69253 | Cre recombinase | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:56 | 0 | |
|
pSR47 Resource Report Resource Website 1+ mentions |
RRID:Addgene_69258 | Cre recombinase | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:51 | 1 | |
|
pSR35 Resource Report Resource Website |
RRID:Addgene_69256 | Cre recombinase | Caenorhabditis elegans | Ampicillin | PMID:26144318 | Backbone Marker:Erik Jorgensen; Backbone Size:8941; Vector Backbone:pCFJ355; Vector Types:Worm Expression, Cre/Lox, MosSCI; Bacterial Resistance:Ampicillin | codon-optimzed index 1.0 | 2026-08-15 01:18:57 | 0 | |
|
pDD315 (mTurquoise2^SEC^2xHA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_73343 | mTurquoise2-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:37351566 | pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 2 | |
|
pDD317 (Pmyo-2::GFP + SEC) Resource Report Resource Website |
RRID:Addgene_73344 | Pmyo-2::GFP + SEC | Caenorhabditis elegans | Ampicillin | PMID:34903234 | pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 0 | |
|
mg319 Resource Report Resource Website 1+ mentions |
RRID:Addgene_73367 | unc-70::TSMod | Caenorhabditis elegans | Ampicillin | PMID:24561618 | Vector Backbone:pEXPR; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 1 | ||
|
JH03 Resource Report Resource Website |
RRID:Addgene_73512 | pmex-5::mKate2::PH::tbb-2 | Caenorhabditis elegans | Ampicillin | PMID:27385332 | Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:29 | 0 | ||
|
JH02 Resource Report Resource Website |
RRID:Addgene_73511 | pmex-5::mCherryo::PH::tbb-2 | Caenorhabditis elegans | Ampicillin | PMID:27385332 | Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
