Plasmids   Select Another Resource Report Type

http://www.addgene.org/48865

Vector Backbone Description: Backbone Size:2051; Vector Backbone:pENTR1A; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. It serves to create intermediate supermodules with plant resistance cassettes. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 358-368bp BsaI site #2 = 1796-1806bp

Proper citation: RRID:Addgene_48865 Copy   

•   Source: Addgene

http://www.addgene.org/48860

Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed to take up inserts for future Golden Gate cloning using the BsaI enzyme. The 5' BsaI overhang can be exchanged using HindIII and BamHI. The 3' BsaI overhang can be exchanged using KpnI and EcoRI. BamHI and KpnI sites as well as the double XcmI sites can also be used as alternative insert cloning sites, instead of using BsaI. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BsaI site #2 = 3315-3325bp

Proper citation: RRID:Addgene_48860 Copy   

•   Source: Addgene

http://www.addgene.org/48851

Species: Synthetic
Genetic Insert: H-A adapter - short
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp H-A adapter = 2252-2271bp BsaI site #2 = 2272-2282bp

Proper citation: RRID:Addgene_48851 Copy   

•   Source: Addgene

http://www.addgene.org/48856

Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed to take up inserts for future Golden Gate cloning using the BsaI enzyme. The 5' BsaI overhang can be exchanged using HindIII and BamHI. The 3' BsaI overhang can be exchanged using KpnI and EcoRI. BamHI and KpnI sites as well as the double XcmI sites can also be used as alternative insert cloning sites, instead of using BsaI. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BsaI site #2 = 3315-3325bp

Proper citation: RRID:Addgene_48856 Copy   

•   Source: Addgene

http://www.addgene.org/48850

Species: Synthetic
Genetic Insert: F-H adapter - short
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp F-H adapter = 2252-2271bp BsaI site #2 = 2272-2282bp

Proper citation: RRID:Addgene_48850 Copy   

•   Source: Addgene

http://www.addgene.org/48849

Species: Synthetic
Genetic Insert: pMAS::SulfadiazineR::t35S
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp Sulfadiazine resistance cassette with MAS promoter and 35S terminator = 2252-3882bp BsaI site #2 = 3883-3893bp

Proper citation: RRID:Addgene_48849 Copy   

•   Source: Addgene

http://www.addgene.org/48848

Species: Synthetic
Genetic Insert: pNOS::BastaR::tNOS
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BASTA resistance cassette with NOS promoter and terminator = 2252-3334bp BsaI site #2 = 3335-3345bp

Proper citation: RRID:Addgene_48848 Copy   

•   Source: Addgene

http://www.addgene.org/48841

Species: Arabidopsis thaliana
Genetic Insert: UBQ10 terminator
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp UBQ10 terminator = 2252-2879bp BsaI site #2 = 2880-2890bp

Proper citation: RRID:Addgene_48841 Copy   

•   Source: Addgene

http://www.addgene.org/48837

Species: Arabidopsis thaliana
Genetic Insert: linker:nuclear localization signal
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-nuclear localization signal = 2252-2550bp BsaI site #2 = 2551-2561bp

Proper citation: RRID:Addgene_48837 Copy   

•   Source: Addgene

http://www.addgene.org/48831

Species: Synthetic
Genetic Insert: 3xmCherry
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp 3x mCherry coding sequence = 2252-4491bp BsaI site #2 = 4492-4502bp

Proper citation: RRID:Addgene_48831 Copy   

•   Source: Addgene

http://www.addgene.org/48835

Species: Synthetic
Genetic Insert: Linker-mCherry
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-mCherry = 2252-3063bp BsaI site #2 = 3064-3074bp

Proper citation: RRID:Addgene_48835 Copy   

•   Source: Addgene

http://www.addgene.org/48834

Species: Synthetic
Genetic Insert: D-Dummy
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp D-dummy = 2252-2297bp BsaI site #2 = 2298-2308bp

Proper citation: RRID:Addgene_48834 Copy   

•   Source: Addgene

http://www.addgene.org/48819

Species: Synthetic
Genetic Insert: mCherry:Linker
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376629
Comments: This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp mCherry-linker = 2252-3060bp BsaI site #2 = 3061-3071bp

Proper citation: RRID:Addgene_48819 Copy   

•   Source: Addgene

http://www.addgene.org/48998

Species: E. coli
Genetic Insert: Recoded E. coli genome with all instances of the UAG codon and RF1 removed (UAG termination function removed)
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::[lcI857 N(cro-ea59)::tetR-bla] Delta prfA Delta mutS::zeoR; all 321 UAG codons changed to UAA This strain is mutS-, which causes a spontaneous mutation frequency of ~2E-8. This strain is auxotrophic for d-biotin. A mutS+ version of this strain will be deposited with addgene soon. Genome sequence deposited at NCBI (accession # CP006698)

Proper citation: RRID:Addgene_48998 Copy   

•   Source: Addgene

http://www.addgene.org/49044

Vector Backbone Description: Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013198

Proper citation: RRID:Addgene_49044 Copy   

•   Source: Addgene

http://www.addgene.org/49042

Vector Backbone Description: Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013198

Proper citation: RRID:Addgene_49042 Copy   

•   Source: Addgene

http://www.addgene.org/48993

Genetic Insert: aminoglycoside 3' phosphotransferase
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_48993 Copy   

•   Source: Addgene

http://www.addgene.org/49048

Species: Bos taurus
Genetic Insert: Enteropeptidase, peptidase domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24184090

Proper citation: RRID:Addgene_49048 Copy   

•   Source: Addgene

http://www.addgene.org/49046

Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49046 Copy   

•   Source: Addgene

http://www.addgene.org/49045

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_49045 Copy   

•   Source: Addgene