Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDonor MCS Rosa26 Resource Report Resource Website 10+ mentions |
RRID:Addgene_37200 | Rosa26 left targeting arm | Mus musculus | Ampicillin | PMID:22169954 | The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich. | Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 10 | |
|
UQ4884 Resource Report Resource Website |
RRID:Addgene_37161 | rcoM2 in pEXT20 | Burkholderia xenovorans | Ampicillin | PMID:18326575 | This strain contains Roberts lab plasmid pUX2397 which contains an EcoRI-HindIII fragment bearing Burkholderia xenovorans LB400 rcoM2 cloned into pEXT20. Suitable for expression of Burkholderia xenovorans RcoM2 protein (untagged). Host strain is E. coli VJS6737. For strain usage see attached pdf. | Vector Backbone:pEXT20; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
UQ4803 Resource Report Resource Website |
RRID:Addgene_37162 | rcoM1 in pEXT20 | Burkholderia xenovorans | Ampicillin | PMID:18326575 | This strain contains Roberts lab plasmid pUX2410 which is an pUX2396 derivative suitable for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag. Host strain is E. coli VJS6737. For strain usage see attached pdf. | Vector Backbone:pUX2410; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
UQ4876 Resource Report Resource Website |
RRID:Addgene_37164 | ~1200-bp fragment from Burkholderia xenovorans LB400 cloned into pEXT20 | Burkholderia xenovorans | Ampicillin and Kanamycin | PMID:18326575 | This strain contains Roberts lab plasmid pUX2442 which contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1 – intergenic region – coxM1′->) – SalI] cloned into pEXT20 with the lacZ + KanR cassette from pKOK6 cloned at the SalI site such that coxM1′::lacZ->tfd<-KanR. Suitable template for amplification of the Burkholderia xenovorans RcoM1 binding region + reporter cassette. For strain usage see attached pdf. | Vector Backbone:pUX2442; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:14:13 | 0 | |
|
UQ5871 Resource Report Resource Website |
RRID:Addgene_37170 | coxM1′::lacZ reporter system with RcoM binding sites "d + e + f" | Kanamycin | This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmid pUX3009 (pUX2996 based coxM1′::lacZ reporter system with RcoM binding sites "d + e + f"). Strain is CmR, pUX3007 is KanR and SpecR. Can be grown on Kan only. For strain usage see attached pdf. | Vector Backbone:pUX3009; Vector Types:; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:13 | 0 | |||
|
UQ5876 Resource Report Resource Website |
RRID:Addgene_37171 | coxM1′::lacZ reporter system with RcoM binding sites "d + e + f" AND RcoM1 with C-term 6xHIS tag | Ampicillin and Kanamycin | This is Roberts lab strain UQ5853 (Addgene #37159) containing Roberts lab plasmids pUX3009 (coxM1′::lacZ reporter system with binding sites “d + e + f”) AND pUX2410 (for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag). Strain is CmR, pUX3009 is KanR and SpecR, pUX2410 is AmpR. Can be grown in Amp + Kan. For strain usage see attached pdf. | Vector Backbone:pUX3009 AND pUX2410; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:14:13 | 0 | |||
|
pDR125 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37150 | lig4 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 2 | |||
|
pDR121 Resource Report Resource Website |
RRID:Addgene_37148 | XRCC6 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
pDR123 Resource Report Resource Website |
RRID:Addgene_37149 | XRCC5 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
pENTR-E2F1-PIP3A Resource Report Resource Website |
RRID:Addgene_37142 | E2F1-P!P3A | Drosophila melanogaster | Kanamycin | PMID:19081076 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | I153, Y156, Y157 to Alanine | 2026-08-15 01:14:13 | 0 | |
|
pLK65 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37257 | vang-like 2 | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP hVangl2 WT | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | |
|
pLSSmOrange-alpha-Tubulin Resource Report Resource Website |
RRID:Addgene_37137 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:5327; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 0 | ||
|
pKeratin-LSSmOrange Resource Report Resource Website |
RRID:Addgene_37138 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:5279; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 0 | ||
|
pActinin-LSSmOrange Resource Report Resource Website 1+ mentions |
RRID:Addgene_37139 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:6655; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 2 | ||
|
pLSSmOrange-mKate2 caspase-3 biosensor Resource Report Resource Website 1+ mentions |
RRID:Addgene_37132 | LSSmOrange-DEVD-mKate2 | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:3959; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:12 | 1 | ||
|
pVimentin-LSSmOrange Resource Report Resource Website |
RRID:Addgene_37134 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:5390; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 0 | ||
|
pMito-LSSmOrange Resource Report Resource Website |
RRID:Addgene_37135 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:4039; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:13 | 0 | ||
|
pLK27 Resource Report Resource Website |
RRID:Addgene_37256 | Scribble | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP C-term | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1197-1630 | 2026-08-15 01:14:13 | 0 |
|
pLSSmOrange-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37130 | LSSmOrange | Kanamycin | PMID:22486524 | Backbone Marker:Clontech; Backbone Size:4013; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP) | 2026-08-15 01:14:12 | 2 | ||
|
pLK01 Resource Report Resource Website |
RRID:Addgene_37252 | Scribble | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP-95-1630 hScrib | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 95-1630 | 2026-08-15 01:14:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
