Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGGN000
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48865 Chloramphenicol and Kanamycin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. It serves to create intermediate supermodules with plant resistance cassettes. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 358-368bp BsaI site #2 = 1796-1806bp Backbone Size:2051; Vector Backbone:pENTR1A; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Kanamycin 2026-08-15 01:15:54 1
pGGE000
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48860 Chloramphenicol and Ampicillin PMID:24376629 This plasmid is designed to take up inserts for future Golden Gate cloning using the BsaI enzyme. The 5' BsaI overhang can be exchanged using HindIII and BamHI. The 3' BsaI overhang can be exchanged using KpnI and EcoRI. BamHI and KpnI sites as well as the double XcmI sites can also be used as alternative insert cloning sites, instead of using BsaI. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BsaI site #2 = 3315-3325bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:54 2
pGGG002
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48851 H-A adapter - short Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp H-A adapter = 2252-2271bp BsaI site #2 = 2272-2282bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 1
pGGA000
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48856 Chloramphenicol and Ampicillin PMID:24376629 This plasmid is designed to take up inserts for future Golden Gate cloning using the BsaI enzyme. The 5' BsaI overhang can be exchanged using HindIII and BamHI. The 3' BsaI overhang can be exchanged using KpnI and EcoRI. BamHI and KpnI sites as well as the double XcmI sites can also be used as alternative insert cloning sites, instead of using BsaI. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BsaI site #2 = 3315-3325bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate Compatible cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:54 4
pGGG001
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48850 F-H adapter - short Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp F-H adapter = 2252-2271bp BsaI site #2 = 2272-2282bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 1
pGGF012
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48849 pMAS::SulfadiazineR::t35S Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp Sulfadiazine resistance cassette with MAS promoter and 35S terminator = 2252-3882bp BsaI site #2 = 3883-3893bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin internal BsaI recognition sites in SulfR removed by silent substitutions 2026-08-15 01:15:54 1
pGGF008
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48848 pNOS::BastaR::tNOS Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp BASTA resistance cassette with NOS promoter and terminator = 2252-3334bp BsaI site #2 = 3335-3345bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin chi sequence in BastaR removed by silent substitution 2026-08-15 01:15:54 1
pGGE009
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48841 UBQ10 terminator Arabidopsis thaliana Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp UBQ10 terminator = 2252-2879bp BsaI site #2 = 2880-2890bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 3
pGGD007
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48837 linker:nuclear localization signal Arabidopsis thaliana Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-nuclear localization signal = 2252-2550bp BsaI site #2 = 2551-2561bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 1
pGGC026
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48831 3xmCherry Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp 3x mCherry coding sequence = 2252-4491bp BsaI site #2 = 4492-4502bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 2
pGGD003
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48835 Linker-mCherry Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp linker-mCherry = 2252-3063bp BsaI site #2 = 3064-3074bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 1
pGGD002
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48834 D-Dummy Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp D-dummy = 2252-2297bp BsaI site #2 = 2298-2308bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:54 4
pGGB001
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48819 mCherry:Linker Synthetic Ampicillin PMID:24376629 This plasmid is designed for Golden Gate cloning using the BsaI enzyme. Plasmid Features (listed as bp in full plasmid sequence): BsaI site #1 = 2241-2251bp mCherry-linker = 2252-3060bp BsaI site #2 = 3061-3071bp Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Golden Gate compatible cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:53 1
C321.ΔA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_48998 Recoded E. coli genome with all instances of the UAG codon and RF1 removed (UAG termination function removed) E. coli Ampicillin PMID:24136966 E. coli MG1655 Delta(ybhB-bioAB)::[lcI857 N(cro-ea59)::tetR-bla] Delta prfA Delta mutS::zeoR; all 321 UAG codons changed to UAA This strain is mutS-, which causes a spontaneous mutation frequency of ~2E-8. This strain is auxotrophic for d-biotin. A mutS+ version of this strain will be deposited with addgene soon. Genome sequence deposited at NCBI (accession # CP006698) Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin See genbank file 2026-08-15 01:15:56 13
EMM71T
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49044 Ampicillin PMID:24013198 Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:55 1
EMM65
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49042 Ampicillin PMID:24013198 Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:56 4
pDONR221-Neo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48993 aminoglycoside 3' phosphotransferase Kanamycin PMID:19432966 Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid. Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin 2026-08-15 01:15:56 1
pET-15b-EK_C122S_His5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49048 Enteropeptidase, peptidase domain Bos taurus Ampicillin PMID:24184090 Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin P92R, E185D, C122S 2026-08-15 01:15:55 4
pJ609 Flag-Sumo1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49046 SUMO1 Homo sapiens Ampicillin Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:55 1
pAC155-pCR8-sgExpression
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49045 Spectinomycin PMID:23979020 Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:56 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch