Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDSG598
 
Resource Report
Resource Website 		RRID:Addgene_214225 PhlF, A118 Spectinomycin PMID:38320549 Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:53 0
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
 
Resource Report
Resource Website 		RRID:Addgene_216249 Cas9 and sgRANGAP.C1 Homo sapiens Ampicillin PMID:38409044 Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, Endogenous tagging; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pCH49 (crRNA expression vector)
 
Resource Report
Resource Website 		RRID:Addgene_217338 AsDR-filler-AsDR8, GFP-neo Synthetic Ampicillin PMID:38760567 Digest with BsmBI to replace filler with sgRNA oligos. Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pcDNA3.1-ARL16-His6
 
Resource Report
Resource Website 		RRID:Addgene_216484 ADP-ribosylation factor like 16 Homo sapiens Ampicillin Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pET28a_Pro-IL-1β
 
Resource Report
Resource Website 		RRID:Addgene_214340 IL1B Homo sapiens Kanamycin PMID:37993712 Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:06:54 0
pGL3-EF1a-i53
 
Resource Report
Resource Website 		RRID:Addgene_216243 i53 Synthetic Ampicillin PMID:38409044 i53 sequence described in Nat Biotechnol. 2018 Jan; 36(1): 95–102.: https://pubmed.ncbi.nlm.nih.gov/29176614/. Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pET3C-ARL16(CO)-His6
 
Resource Report
Resource Website 		RRID:Addgene_216485 ADP-ribosylation factor-like 16 Homo sapiens Ampicillin Backbone Size:4638; Vector Backbone:pET3C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
pCH4 (denAsCas12a-KRAB lenti)
 
Resource Report
Resource Website 		RRID:Addgene_217331 denAsCas12a Acidaminococcus Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Backbone Marker:Marco Jost, Jonathan Weissman; Vector Backbone:Addgene plasmid # 188765; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin D908A/E174R/S542R/K548R Addgene 2026-10-10 02:06:54 0
pDSG594
 
Resource Report
Resource Website 		RRID:Addgene_214221 PhlF, A118 Spectinomycin PMID:38320549 Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:53 0
pDSG595
 
Resource Report
Resource Website 		RRID:Addgene_214222 PhlF, A118 Spectinomycin PMID:38320549 Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:53 0
pDSG596
 
Resource Report
Resource Website 		RRID:Addgene_214223 PhlF, A118 Spectinomycin PMID:38320549 Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:53 0
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
 
Resource Report
Resource Website 		RRID:Addgene_216248 HDR template for human RANGAP1 Homo sapiens Ampicillin PMID:38409044 Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, TALEN, HDR template; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
Human V5-USP47
 
Resource Report
Resource Website 		RRID:Addgene_217626 USP47 Homo sapiens Ampicillin PMID:36749823 Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
OPEN HLA-A*02:01-BirA
 
Resource Report
Resource Website 		RRID:Addgene_215569 OPEN HLA-A*02:01 Homo sapiens Kanamycin PMID:37310998 Backbone Size:5242; Vector Backbone:pET24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Glycine 120 to Cysteine Addgene 2026-10-10 02:06:54 0
pGAL4-DBD-CEBPa-AroLITE_A
 
Resource Report
Resource Website 		RRID:Addgene_215602 CEBPa AroLITE Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
gCH29 (crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217344 crCD81-1 Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217341 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
Drosophila Wdr20-V5
 
Resource Report
Resource Website 		RRID:Addgene_217622 WDR20 Drosophila melanogaster Ampicillin PMID:37798281 Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217345 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0
Drosophila Usp46-V5
 
Resource Report
Resource Website 		RRID:Addgene_217620 USP46 Drosophila melanogaster Ampicillin PMID:37798281 Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:54 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch