Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: PhlF, A118
Vector Backbone Description: Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38320549
Proper citation: RRID:Addgene_214225 Copy
Species: Homo sapiens
Genetic Insert: Cas9 and sgRANGAP.C1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, Endogenous tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Proper citation: RRID:Addgene_216249 Copy
Species: Synthetic
Genetic Insert: AsDR-filler-AsDR8, GFP-neo
Vector Backbone Description: Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Digest with BsmBI to replace filler with sgRNA oligos.
Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217338 Copy
Species: Homo sapiens
Genetic Insert: ADP-ribosylation factor like 16
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216484 Copy
Species: Homo sapiens
Genetic Insert: IL1B
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37993712
Proper citation: RRID:Addgene_214340 Copy
Species: Synthetic
Genetic Insert: i53
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Comments: i53 sequence described in Nat Biotechnol. 2018 Jan; 36(1): 95–102.: https://pubmed.ncbi.nlm.nih.gov/29176614/.
Proper citation: RRID:Addgene_216243 Copy
Species: Homo sapiens
Genetic Insert: ADP-ribosylation factor-like 16
Vector Backbone Description: Backbone Size:4638; Vector Backbone:pET3C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216485 Copy
Species: Acidaminococcus
Genetic Insert: denAsCas12a
Vector Backbone Description: Backbone Marker:Marco Jost, Jonathan Weissman; Vector Backbone:Addgene plasmid # 188765; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217331 Copy
Genetic Insert: PhlF, A118
Vector Backbone Description: Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38320549
Proper citation: RRID:Addgene_214221 Copy
Genetic Insert: PhlF, A118
Vector Backbone Description: Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38320549
Proper citation: RRID:Addgene_214222 Copy
Genetic Insert: PhlF, A118
Vector Backbone Description: Vector Backbone:pSB4S5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38320549
Proper citation: RRID:Addgene_214223 Copy
Species: Homo sapiens
Genetic Insert: HDR template for human RANGAP1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, TALEN, HDR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409044
Proper citation: RRID:Addgene_216248 Copy
Species: Homo sapiens
Genetic Insert: USP47
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36749823
Proper citation: RRID:Addgene_217626 Copy
Species: Homo sapiens
Genetic Insert: OPEN HLA-A*02:01
Vector Backbone Description: Backbone Size:5242; Vector Backbone:pET24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37310998
Proper citation: RRID:Addgene_215569 Copy
Species: Homo sapiens
Genetic Insert: CEBPa AroLITE
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215602 Copy
Species: Homo sapiens
Genetic Insert: crCD81-1
Vector Backbone Description: Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217344 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217341 Copy
Species: Drosophila melanogaster
Genetic Insert: WDR20
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37798281
Proper citation: RRID:Addgene_217622 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38760567
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217345 Copy
Species: Drosophila melanogaster
Genetic Insert: USP46
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37798281
Proper citation: RRID:Addgene_217620 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
