Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: DmRoquin_702-819-del790-812
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from isoform C NCBI:NM_001275011.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148623 Copy
Species: Drosophila melanogaster
Genetic Insert: DmRoquin_702-819
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from isoform C NCBI:NM_001275011.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148624 Copy
Species: Drosophila melanogaster
Genetic Insert: DmRoquin_702-819-ILLVtoEEEE
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from isoform C NCBI:NM_001275011.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148625 Copy
Species: Drosophila melanogaster
Genetic Insert: DmRoquin_702-819-L805EV809E
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from isoform C NCBI:NM_001275011.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148626 Copy
Species: Drosophila melanogaster
Genetic Insert: DmRoquin_790-810
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from isoform C NCBI:NM_001275011.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148628 Copy
Species: Homo sapiens
Genetic Insert: HsRoquin1_510-1133
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28165457
Comments: ORF extracted from NCBI: NM_172071.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148632 Copy
Species: Synthetic
Genetic Insert: DmNot4_813-836opt
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30692204
Comments: synthesized DNA from GeneArt. Codon optimized for Expression in E.coli Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148793 Copy
Species: Drosophila melanogaster
Genetic Insert: DmBam_13-36
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29255063
Comments: sequence given by UniProt.: P22745 (NCBI NM:057452.3). Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148830 Copy
Species: Drosophila melanogaster
Genetic Insert: DmBam
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29255063
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148831 Copy
Species: Drosophila melanogaster
Genetic Insert: DmBam-L17E
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29255063
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148835 Copy
Genetic Insert: tetracysteine-TEM1
Vector Backbone Description: Vector Backbone:p2-39; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36550144
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.08.450573v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_194630 Copy
Species: Synthetic
Genetic Insert: mScarlet-I
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.03.26.437257v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_185943 Copy
Vector Backbone Description: Backbone Marker:Spaink; Backbone Size:15000; Vector Backbone:pMP184; Vector Types:Bacterial Expression, IncQ; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24276795
Comments: The plasmid also confers streptomycin resistance.
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_185922 Copy
Species: n/a
Genetic Insert: Replaced lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24382032
Comments: MK01 strain was derived by knocking out the endogenous lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783. The parent strain encodes araC gene but carries a deletion for the arabinose metabolizing genes, ∆(araH-araF). The all-or-none response of araBAD promoter (PBAD) response is overcome by inserting a copy of the low-affinity high-capacity transporter, araE, under the control of an arabinose-independent promoter.
Proper citation: RRID:Addgene_195090 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG
Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG
Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC
Proper citation: RRID:Addgene_195857 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - CTGTCAGATCCATAGCGAATC
Antisense PCR primer (5'-->3') - CTCTGACCTGACTGAACAATAC
Sequencing primer (5'-->3') - GCTATCCGGCAGCTTCTTAAT
Proper citation: RRID:Addgene_195856 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195859 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TCCTTCTCTGGTGTTGTTTG
Antisense PCR primer (5'-->3') - TTGGCTGCTCTGACTTTG
Sequencing primer (5'-->3') - CGGTTGACCTTGAGAGAGTTAAT
Proper citation: RRID:Addgene_195858 Copy
Species: Acropora millepora
Genetic Insert: Chromogenic Protein on pRCP plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCP; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195860 Copy
Species: Acropora millepora
Genetic Insert: Chromogenic Protein
Vector Backbone Description: Backbone Marker:Reference for backbone - PMID: 10723548; Vector Backbone:pDHC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195862 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
