Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Lyn-CFP-GAI(1-172)
 
Resource Report
Resource Website
RRID:Addgene_37313 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB. Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-172 2026-08-15 01:14:14 0
Lyn-CFP-GAI(1-532)
 
Resource Report
Resource Website
RRID:Addgene_37314 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB. Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-532 2026-08-15 01:14:14 0
Lyn-mCherry-GAI(1-92)
 
Resource Report
Resource Website
RRID:Addgene_37315 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Vector Backbone:Lyn-mCherry-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-92 2026-08-15 01:14:14 0
pCS2TAL3-DD
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_37275 Ampicillin PMID:22916025 For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald Backbone Size:4168; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 12
pTK21
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37396 Ran Homo sapiens Kanamycin PMID:22327364 Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation. Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T24N 2026-08-15 01:14:14 7
pCS2TAL3-RR
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_37276 Ampicillin PMID:22916025 For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald Backbone Size:4039; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 11
CFP-GAI(1-532)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37310 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-532 2026-08-15 01:14:14 1
pYUBDuet
 
Resource Report
Resource Website
RRID:Addgene_37278 Hygromycin PMID:21209917 Backbone Marker:Ghader Bashiri; Backbone Size:5087; Vector Backbone:pYUB1049; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin 2026-08-15 01:14:14 0
Lyn-CFP-GAI(1-92)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37311 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB. Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-92 2026-08-15 01:14:14 1
Foxd3 CreERT2 RMCE Insertion Vector
 
Resource Report
Resource Website
RRID:Addgene_37272 Foxd3 Mus musculus Ampicillin Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
10XSTAT92E–luciferase
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_37393 SOCS36E enhancer fragment Drosophila melanogaster Ampicillin PMID:16055650 Perrimon Lab plasmid #446 A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI). Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E. Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70. Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase. Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 2
pHygroMod-Foxd3-3xFlag
 
Resource Report
Resource Website
RRID:Addgene_37274 Foxd3 Mus musculus Ampicillin Vector Backbone:unknown; Vector Types:Mouse Targeting, Insertion vector for RMCE; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
ovoD1 D1B2NR (18 kb)
 
Resource Report
Resource Website
RRID:Addgene_37280 ovoD1 genomic DNA fragment Drosophila melanogaster Ampicillin PMID:8306893 Perrimon Lab plasmid #23 Please see associated publication for cloning details Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
CFP-GAI(1-92)
 
Resource Report
Resource Website
RRID:Addgene_37307 GAI Arabidopsis thaliana Kanamycin PMID:22446836 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin contains aa 1-92 2026-08-15 01:14:14 0
pFoxd3floxtv
 
Resource Report
Resource Website
RRID:Addgene_37268 Foxd3 Mus musculus Ampicillin PMID:18367558 Backbone Size:3000; Vector Backbone:pPNT4; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pUAS-hopscotch
 
Resource Report
Resource Website
RRID:Addgene_37301 hopscotch Drosophila melanogaster Ampicillin PMID:7796812 Perrimon Lab plasmid #100 Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:14 0
pCaShs-Tum
 
Resource Report
Resource Website
RRID:Addgene_37303 hopTum-1 Drosophila melanogaster Ampicillin PMID:7796812 Perrimon Lab plasmid #101 The pCaShs-Tum construct was generated by the replacement of a 220 bp SacII-BstEII fragment from pCaShs-hop (Addgene plasmid# 37299) with the same fragment of PCR-generated DNA from hopTum-1 hemizygous flies. This mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341. Backbone Marker:Addgene plasmid# 37299; Vector Backbone:pCaShs-hopscotch; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Tul-l mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341 2026-08-15 01:14:14 0
pUAS-Tum
 
Resource Report
Resource Website
RRID:Addgene_37304 hopTum-1 Drosophila melanogaster Ampicillin PMID:7796812 Perrimon Lab plasmid #102 The pUAS-Tum was made by the insertion of the NotI-XbaI fragment from pCaShs-Tum (Addgene plasmid# 37303) into pUAST. Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Tul-l mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341 2026-08-15 01:14:14 0
pFoxd3IRESGFPtv
 
Resource Report
Resource Website
RRID:Addgene_37266 Foxd3 Mus musculus Ampicillin PMID:12381664 Backbone Marker:Stratgene; Backbone Size:3000; Vector Backbone:pBS; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pCS2mFoxd3
 
Resource Report
Resource Website
RRID:Addgene_37267 Foxd3 Mus musculus Ampicillin PMID:17092955 Please note the insert is comprised of the 1.4kb ORF surrounded by UTRs. Backbone Size:4095; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Overexpression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.