Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LSB-hsa-miR-708-3p Resource Report Resource Website |
RRID:Addgene_103724 | hsa-miR-708-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-7-5p Resource Report Resource Website |
RRID:Addgene_103723 | hsa-miR-7-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:37 | 0 | |
|
PB-CAG-CasRX-P2A-EGFP-BGH PolyA Resource Report Resource Website 1+ mentions |
RRID:Addgene_154004 | CasRx | Synthetic | Ampicillin and Kanamycin | PMID:32185621 | INSERT: CasRx & EGFP driven by CAG promoter. | Vector Backbone:PB; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:07:44 | 1 | |
|
FMR1-E17C-3xFLAG Resource Report Resource Website |
RRID:Addgene_157784 | FMR1-FLAG | Homo sapiens | Ampicillin and Kanamycin | PMID:32179589 | Backbone Size:8012; Vector Backbone:Addgene #31938; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:08:08 | 0 | ||
|
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC Resource Report Resource Website |
RRID:Addgene_140198 | dLbCas12a(D156R)-VPR | Synthetic | Ampicillin and Kanamycin | PMID:32526136 | Backbone Marker:DOI: 10.1039/C8SC02870B; Backbone Size:14777; Vector Backbone:pYFAC-riboB; Vector Types:CRISPR, Synthetic Biology, Expression in Aspergillus nidulans and related filamentous fungi.; Bacterial Resistance:Ampicillin and Kanamycin | D832A DNase deactivated, D156R for improved activity at 25 °C | 2026-08-15 01:06:39 | 0 | |
|
PCR4-Shh::lacZ-H11 Resource Report Resource Website 10+ mentions |
RRID:Addgene_139098 | Ampicillin and Kanamycin | PMID:32169219 | Please note that there are minor differences between the Addgene verified result and the depositor's reference sequence (under the supplemental documents section). Please refer to the Addgene NGS result for more accurate sequence information. These differences do not affect the plasmid function. | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:06:31 | 18 | |||
|
PCR4-Hsp68::lacZ-H11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_139099 | Ampicillin and Kanamycin | PMID:32169219 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:06:30 | 2 | ||||
|
Oct4deltaPE-53BP1mCherry Resource Report Resource Website |
RRID:Addgene_141122 | Fragment of human 53BP1 | Homo sapiens | Ampicillin and Kanamycin | PMID:32343484 | Please visit https://www.biorxiv.org/content/10.1101/2020.01.29.925487v1 for bioRxiv preprint. | Vector Backbone:mouse deltaPE Oct4-GFP transgenic reporter (addgene plasmid #52382); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:06:46 | 0 | |
|
pONSY-CoH2B:Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_111877 | Capsaspora Histone H2B (CoH2B) fused to Venus | Capsaspora owczarzaki | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 2 | ||
|
pONSY-Venus Resource Report Resource Website |
RRID:Addgene_111875 | Venus | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 0 | |||
|
pCPP6534 Resource Report Resource Website |
RRID:Addgene_128735 | Ampicillin and Kanamycin | PMID:29742421 | Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. | Vector Backbone:pUC18R6K-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:50 | 0 | |||
|
pCR2.1-KRAS-G12V Resource Report Resource Website |
RRID:Addgene_129091 | KRAS(G12V) | Homo sapiens | Ampicillin and Kanamycin | PMID:25706875 | Vector Backbone:pCR2.1-TOPO cloning vector; Vector Types:homologous recombination donor plasmid; Bacterial Resistance:Ampicillin and Kanamycin | G12V | 2026-08-15 01:04:54 | 0 | |
|
pHAGE2-EF1aL-Cre-IRES-NeoR-W Resource Report Resource Website |
RRID:Addgene_126700 | Cre-IRES | bacteriophage P1, EMCV | Ampicillin and Kanamycin | PMID:28965766 | Backbone Marker:Derived in Kotton lab; Backbone Size:7830; Vector Backbone:pHAGE2; Vector Types:Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:28 | 0 | ||
|
pK_P-ICL1-LM_lacO-cP-AOX1-sAR Resource Report Resource Website |
RRID:Addgene_126744 | slovA,cpr | Aspergillus terreus, Escherichia coli, Komagataella phaffii | Ampicillin and Kanamycin | PMID:31077813 | Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:28 | 0 | ||
|
pK_lacO-cP-AOX1-sAR Resource Report Resource Website |
RRID:Addgene_126743 | slovA,cpr | Aspergillus terreus | Ampicillin and Kanamycin | PMID:31077813 | Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:28 | 0 | ||
|
pKdH_P-GAP-ScADH2+P-GAP*-ScALD6 Resource Report Resource Website |
RRID:Addgene_126737 | adh2,ald6 | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:31077813 | Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:28 | 0 | ||
|
pKdH_P-GAP-ScADH2+P-GAP*-ScACS1* Resource Report Resource Website |
RRID:Addgene_126738 | adh2,acs1* | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:31077813 | Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin | T3542C | 2026-08-15 01:04:28 | 0 | |
|
pK_lacO-cP-AOX1-AtX+NpgA Resource Report Resource Website |
RRID:Addgene_126727 | atX,npgA | Aspergillus terreus, Aspergillus nidulans | Ampicillin and Kanamycin | PMID:31077813 | Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:28 | 0 | ||
|
pAGN33 Resource Report Resource Website |
RRID:Addgene_131105 | P-furA102tetO-pip | Streptomyces pristinaespiralis | Ampicillin and Kanamycin | PMID:30962489 | The sequence is that of pTTP1B with P-furA 102 tetO- pip cloned into the EcoRI site. | Backbone Marker:Graham Hatfull (Addgene plasmid # 91723); Backbone Size:5852; Vector Backbone:pTTP1.B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | the furA102 promoter was mutated with the insertion of 2 tetO sites | 2026-08-15 01:05:14 | 0 |
|
pG3B-U6EC1 Resource Report Resource Website |
RRID:Addgene_134756 | CRISPR/Cas9 | Synthetic | Ampicillin and Kanamycin | PMID:31558579 | Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:05:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
