Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-miR-708-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103724 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-7-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103723 Copy
Species: Synthetic
Genetic Insert: CasRx
Vector Backbone Description: Vector Backbone:PB; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32185621
Comments: INSERT: CasRx & EGFP driven by CAG promoter.
Proper citation: RRID:Addgene_154004 Copy
Species: Homo sapiens
Genetic Insert: FMR1-FLAG
Vector Backbone Description: Backbone Size:8012; Vector Backbone:Addgene #31938; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32179589
Proper citation: RRID:Addgene_157784 Copy
Species: Synthetic
Genetic Insert: dLbCas12a(D156R)-VPR
Vector Backbone Description: Backbone Marker:DOI: 10.1039/C8SC02870B; Backbone Size:14777; Vector Backbone:pYFAC-riboB; Vector Types:CRISPR, Synthetic Biology, Expression in Aspergillus nidulans and related filamentous fungi.; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32526136
Proper citation: RRID:Addgene_140198 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32169219
Comments: Please note that there are minor differences between the Addgene verified result and the depositor's reference sequence (under the supplemental documents section). Please refer to the Addgene NGS result for more accurate sequence information. These differences do not affect the plasmid function.
Proper citation: RRID:Addgene_139098 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32169219
Proper citation: RRID:Addgene_139099 Copy
Species: Homo sapiens
Genetic Insert: Fragment of human 53BP1
Vector Backbone Description: Vector Backbone:mouse deltaPE Oct4-GFP transgenic reporter (addgene plasmid #52382); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32343484
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.01.29.925487v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_141122 Copy
Species: Capsaspora owczarzaki
Genetic Insert: Capsaspora Histone H2B (CoH2B) fused to Venus
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29752387
Proper citation: RRID:Addgene_111877 Copy
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29752387
Proper citation: RRID:Addgene_111875 Copy
Vector Backbone Description: Vector Backbone:pUC18R6K-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29742421
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_128735 Copy
Species: Homo sapiens
Genetic Insert: KRAS(G12V)
Vector Backbone Description: Vector Backbone:pCR2.1-TOPO cloning vector; Vector Types:homologous recombination donor plasmid; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25706875
Proper citation: RRID:Addgene_129091 Copy
Species: bacteriophage P1, EMCV
Genetic Insert: Cre-IRES
Vector Backbone Description: Backbone Marker:Derived in Kotton lab; Backbone Size:7830; Vector Backbone:pHAGE2; Vector Types:Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28965766
Proper citation: RRID:Addgene_126700 Copy
Species: Aspergillus terreus, Escherichia coli, Komagataella phaffii
Genetic Insert: slovA,cpr
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126744 Copy
Species: Aspergillus terreus
Genetic Insert: slovA,cpr
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126743 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: adh2,ald6
Vector Backbone Description: Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126737 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: adh2,acs1*
Vector Backbone Description: Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126738 Copy
Species: Aspergillus terreus, Aspergillus nidulans
Genetic Insert: atX,npgA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126727 Copy
Species: Streptomyces pristinaespiralis
Genetic Insert: P-furA102tetO-pip
Vector Backbone Description: Backbone Marker:Graham Hatfull (Addgene plasmid # 91723); Backbone Size:5852; Vector Backbone:pTTP1.B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30962489
Comments: The sequence is that of pTTP1B with P-furA 102 tetO- pip cloned into the EcoRI site.
Proper citation: RRID:Addgene_131105 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134756 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
