Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,737 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pFP118
 
Resource Report
Resource Website 		RRID:Addgene_21671 Lacz E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been modified, the EcoRV/BclI fragment has been deleted. Second LacZ HO site is no longer present. 2026-08-15 01:12:04 0
pFP121
 
Resource Report
Resource Website 		RRID:Addgene_21670 Lacz E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 20-bp sequence (AGTTTCAGCTTTTTATAAAC), so that the nonhomologous sequences in the cut lacZ repeat are only 10 bp long on each side of the DSB. Second LacZ HO site is no longer present. 2026-08-15 01:12:04 0
pFP125
 
Resource Report
Resource Website 		RRID:Addgene_21674 LacZ E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been completely deleted, and there is no homologous sequence. 2026-08-15 01:12:04 0
pFP122
 
Resource Report
Resource Website 		RRID:Addgene_21669 Lacz E. coli Ampicillin PMID:9343441 Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature. Backbone Marker:W. Kramer; Backbone Size:0; Vector Backbone:Ted; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin The second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 36-bp sequence (AG TTTCAGCTTTCCGCAATAGTATAATTTTATAAAC) which differs from an HO cut site by only one substitution but cannot be cut 2026-08-15 01:12:04 0
pXDC61
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21841 blaM E. coli Chloramphenicol PMID:19578436 Backbone Size:9024; Vector Backbone:pMMB207C; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:12:06 3
pACYC-FLAG-dN6-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22143 Flag-clpXdeltaNLinkedHexamer-His6 E. coli Chloramphenicol PMID:16237435 Backbone Marker:modifiedNovagen; Backbone Size:3500; Vector Backbone:pACYC.pET24cloning; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:12:08 2
Vh-HA-2xDHFR
 
Resource Report
Resource Website 		RRID:Addgene_20218 2xDHFR E. coli Ampicillin PMID:18788807 murine VH chain signal peptide followed by a HA tag and two repeats of DHFR Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:52 0
2xDHFR-myc
 
Resource Report
Resource Website 		RRID:Addgene_20215 2xDHFR E. coli Ampicillin PMID:18788807 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:52 0
Vh-HA-3xDHFR
 
Resource Report
Resource Website 		RRID:Addgene_20219 3xDHFR E. coli Ampicillin PMID:18788807 murine VH chain signal peptide followed by a HA tag and three repeats of DHFR Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:52 0
pDisplay-BirA-ER
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_20856 BirA-ER E. Coli Ampicillin PMID:18425138 Please email [email protected] with the intended use and/or targets for this plasmid. Backbone Size:5300; Vector Backbone:pDisplay; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C-terminal ER targeting sequence (KDEL) 2026-08-15 01:11:57 22
pcDNA3.1-subtilase A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35948 Subtilase A E. Coli Ampicillin PMID:21857923 Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:07 1
pST5832
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36256 lacZ E. coli Kanamycin PMID:22279533 The plasmid is high copy in E. coli, but low copy in mycobacteria. Cloning was done via assembly PCR, sot he XbaI-HindIII fragment comprises the promoter-riboswitch. The insert is 3361bp including the promoter. There are mismatches between Addgene's quality control sequence and the depositor sequence, but they are not known to affect plasmid function. Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin 2026-08-15 01:14:06 1
pHL1559
 
Resource Report
Resource Website 		RRID:Addgene_37570 CsrB E. coli Kanamycin PMID:23878244 Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:14:15 0
pHL600
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_37563 CsrB E. coli Kanamycin PMID:23878244 Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:14:15 1
pHL601
 
Resource Report
Resource Website 		RRID:Addgene_37564 CsrC E. coli Kanamycin PMID:23878244 Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:14:15 0
pInducer10-mir-RUP-PheS
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_44011 PheS Gly294 E. coli Ampicillin PMID:21307310 Backbone Marker:Open Biosystems; Backbone Size:13167; Vector Backbone:pGIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:11 19
pET29b-clbI
 
Resource Report
Resource Website 		RRID:Addgene_114151 clbI E. coli Kanamycin PMID:26890481 Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:02:19 0
pET29b-clbG
 
Resource Report
Resource Website 		RRID:Addgene_114150 clbG E. coli Kanamycin PMID:26890481 Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:02:19 0
pET28a-clbH
 
Resource Report
Resource Website 		RRID:Addgene_114156 clbH E. coli Kanamycin PMID:28805802 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:02:19 0
pET29b-clbI S178A
 
Resource Report
Resource Website 		RRID:Addgene_114159 clbI E. coli Kanamycin PMID:28805802 Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Mutated S178 to Ala 2026-08-15 01:02:19 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch