Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: PECAM promoter/enhancer
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5800; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14982871
Proper citation: RRID:Addgene_14686 Copy
Species: Mus musculus
Genetic Insert: p97
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:3300; Vector Backbone:pQE9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11740563
Proper citation: RRID:Addgene_14667 Copy
Species: Mus musculus
Genetic Insert: p97
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:3300; Vector Backbone:pQE9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10811609
Comments: Addgene NGS results identified a V206 variant in p97 that matches NCBI reference CAA78412.1.
Proper citation: RRID:Addgene_14666 Copy
Species: Mus musculus
Genetic Insert: Myf5
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231
Proper citation: RRID:Addgene_14711 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10733231
Proper citation: RRID:Addgene_14710 Copy
Species: Mus musculus
Genetic Insert: MKK7b1(K149A)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090
Proper citation: RRID:Addgene_14674 Copy
Species: Mus musculus
Genetic Insert: MKK7b1(Glu)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891090
Proper citation: RRID:Addgene_14673 Copy
Species: Mus musculus
Genetic Insert: FIG alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9362457
Proper citation: RRID:Addgene_14643 Copy
Species: Mus musculus
Genetic Insert: ZP1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7635043
Proper citation: RRID:Addgene_14644 Copy
Species: Mus musculus
Genetic Insert: Axin
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12717450
Proper citation: RRID:Addgene_14716 Copy
Species: Mus musculus
Genetic Insert: Dicer shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: GATCCCCGAG CGCCGATCTC TAATTATTCA AGAGATAATT AGAGATCGGC GCTCTTTTTG GAAC
Proper citation: RRID:Addgene_14777 Copy
Species: Mus musculus
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: GATCCCCAGA ACTACACGTC CATCAATTCA AGAGATTGAT GGACGTGTAG TTCTTTTTTG GAAC
Proper citation: RRID:Addgene_14776 Copy
Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14789 Copy
Species: Mus musculus
Genetic Insert: let-7g
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’.
Proper citation: RRID:Addgene_14784 Copy
Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Proper citation: RRID:Addgene_14785 Copy
Species: Mus musculus
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: GATCCCCCAA CAGTCATAGA ATATGATTCA AGAGATCATA TTCTATGACT GTTGTTTTTG GAAC
Proper citation: RRID:Addgene_14780 Copy
Species: Mus musculus
Genetic Insert: Dicer shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGCATGGTGG TGTCGATATT TTCAAGAGAA ATATCGACAC CACCATGCTT TTTTC
Proper citation: RRID:Addgene_14781 Copy
Species: Mus musculus
Genetic Insert: Hmga2 truncated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14793 Copy
Species: Mus musculus
Genetic Insert: Hmga2 m7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Full sequence of wild-type plasmid available at Addgene plasmid #14789.
Proper citation: RRID:Addgene_14792 Copy
Species: Mus musculus
Genetic Insert: Hmga2 m2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Full sequence of wild-type plasmid available at Addgene plasmid #14789.
Proper citation: RRID:Addgene_14790 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
