Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: ChrII_ttTi5605 sgRNA
Vector Backbone Description: Vector Backbone:pTK73; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36640369
Comments: An identical plasmid has been reported by Dr. Shinsuke Niwa's group.
doi.org/10.1371/journal.pone.0197128
Proper citation: RRID:Addgene_194058 Copy
Species: Caenorhabditis elegans
Genetic Insert: lim-4
Vector Backbone Description: Vector Backbone:pPD95.62; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33378642
Proper citation: RRID:Addgene_191028 Copy
Species: Caenorhabditis elegans
Genetic Insert: glr-4
Vector Backbone Description: Vector Backbone:pPD95.62; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33378642
Proper citation: RRID:Addgene_191084 Copy
Species: Caenorhabditis elegans
Genetic Insert: wiRFP713-T2A-HO1
Vector Backbone Description: Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197247 Copy
Species: Caenorhabditis elegans
Genetic Insert: wemiRFP670-T2A-HO1
Vector Backbone Description: Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197243 Copy
Species: Caenorhabditis elegans
Genetic Insert: H2B::GFP
Vector Backbone Description: Backbone Size:5496; Vector Backbone:pCFJ910; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37214099
Proper citation: RRID:Addgene_196063 Copy
Species: Caenorhabditis elegans
Genetic Insert: [AFDp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.
Proper citation: RRID:Addgene_200338 Copy
Species: Caenorhabditis elegans
Genetic Insert: 5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
Vector Backbone Description: Vector Backbone:pMS137; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215679 Copy
Species: Caenorhabditis elegans
Genetic Insert: 5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
Vector Backbone Description: Vector Backbone:pMS63; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905
Proper citation: RRID:Addgene_215674 Copy
Species: Caenorhabditis elegans
Genetic Insert: GtAR2
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:7216; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38598630
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
Proper citation: RRID:Addgene_200780 Copy
Species: Caenorhabditis elegans
Genetic Insert: GtACR2
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8806; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38598630
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
Proper citation: RRID:Addgene_200781 Copy
Species: Caenorhabditis elegans
Genetic Insert: twk-40
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:9792; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38598630
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
Proper citation: RRID:Addgene_200160 Copy
Species: Caenorhabditis elegans
Genetic Insert: zif-1
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:10341; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38598630
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
Proper citation: RRID:Addgene_200043 Copy
Species: Caenorhabditis elegans
Genetic Insert: Synaptogyrin-CRY2 (E490G + residues 1-535)
Vector Backbone Description: Vector Backbone:pCFJ201; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36535932
Proper citation: RRID:Addgene_197598 Copy
Species: Caenorhabditis elegans
Genetic Insert: snb-1
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:9950; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38598630
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
Proper citation: RRID:Addgene_200108 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-22 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GAACCCGTTGCCGAATACAC
Proper citation: RRID:Addgene_58202 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-207
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59554 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59551 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59552 Copy
Species: Caenorhabditis elegans
Genetic Insert: cdc-42 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59785 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
