Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
PECAM-eGFP-Hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_14686 | PECAM promoter/enhancer | Mus musculus | Kanamycin | PMID:14982871 | Backbone Marker:Clontech; Backbone Size:5800; Vector Backbone:EGFP-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:07:06 | 1 | ||
|
pQE9-His-p97(QQ) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14667 | p97 | Mus musculus | Ampicillin | PMID:11740563 | Backbone Marker:Qiagen; Backbone Size:3300; Vector Backbone:pQE9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | E305/578Q | 2026-08-15 01:07:05 | 2 | |
|
pQE9-His-p97(wt) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14666 | p97 | Mus musculus | Ampicillin | PMID:10811609 | Addgene NGS results identified a V206 variant in p97 that matches NCBI reference CAA78412.1. | Backbone Marker:Qiagen; Backbone Size:3300; Vector Backbone:pQE9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | See depositor comments below. | 2026-08-15 01:07:06 | 5 |
|
EMSV-Myf5 (puro) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14711 | Myf5 | Mus musculus | Ampicillin | PMID:10733231 | Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:06 | 1 | ||
|
EMSV-MyoD (puro) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14710 | MyoD | Mus musculus | Ampicillin | PMID:10733231 | Backbone Size:5300; Vector Backbone:EMSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:06 | 1 | ||
|
pCDNA3 MKK7b1(K149A) Resource Report Resource Website |
RRID:Addgene_14674 | MKK7b1(K149A) | Mus musculus | Ampicillin | PMID:9891090 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lys-149Ala | 2026-08-15 01:07:05 | 0 | |
|
pCDNA3 Flag MKK7b1(glu) Resource Report Resource Website |
RRID:Addgene_14673 | MKK7b1(Glu) | Mus musculus | Ampicillin | PMID:9891090 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser-269Glu Thr-273Glu | 2026-08-15 01:07:06 | 0 | |
|
Mouse FIGalpha (JD#435) Resource Report Resource Website |
RRID:Addgene_14643 | FIG alpha | Mus musculus | Ampicillin | PMID:9362457 | Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:05 | 0 | ||
|
Mouse ZP1 (JD#264) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14644 | ZP1 | Mus musculus | Ampicillin | PMID:7635043 | Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:05 | 1 | ||
|
MSCV-Axin-IRES-GFP Resource Report Resource Website |
RRID:Addgene_14716 | Axin | Mus musculus | Ampicillin | PMID:12717450 | Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 0 | ||
|
pSuper mouse Dicer2 Resource Report Resource Website |
RRID:Addgene_14777 | Dicer shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: GATCCCCGAG CGCCGATCTC TAATTATTCA AGAGATAATT AGAGATCGGC GCTCTTTTTG GAAC | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 0 | |
|
pSuper mouse Drosha3 Resource Report Resource Website |
RRID:Addgene_14776 | Drosha shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: GATCCCCAGA ACTACACGTC CATCAATTCA AGAGATTGAT GGACGTGTAG TTCTTTTTTG GAAC | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 0 | |
|
pcDNA3.1 Hmga2 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_14789 | Hmga2 wt | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 3 | |
|
MSCV let-7g Resource Report Resource Website 1+ mentions |
RRID:Addgene_14784 | let-7g | Mus musculus | Ampicillin | PMID:17401365 | miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’. | Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:08 | 1 | |
|
Hmga2 3'UTR wt luciferase (Luc-wt) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14785 | Luc-wt | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1. | Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 8 | |
|
pSuper mouse Drosha1 Resource Report Resource Website |
RRID:Addgene_14780 | Drosha shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: GATCCCCCAA CAGTCATAGA ATATGATTCA AGAGATCATA TTCTATGACT GTTGTTTTTG GAAC | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:08 | 0 | |
|
pSicoR mouse Dicer3 Resource Report Resource Website |
RRID:Addgene_14781 | Dicer shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: TGCATGGTGG TGTCGATATT TTCAAGAGAA ATATCGACAC CACCATGCTT TTTTC | Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 0 | |
|
pcDNA3.1 Hmga2 tr Resource Report Resource Website |
RRID:Addgene_14793 | Hmga2 truncated | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | truncataed HMGA2. As in human tumors, Hmga2-tr lacks the spacer, the acidic domain, and the entire 3' UTR with its miRNA complementary sites. (see article and author's map for details) | 2026-08-15 01:07:07 | 0 |
|
pcDNA3.1 Hmga2 m7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_14792 | Hmga2 m7 | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen). Full sequence of wild-type plasmid available at Addgene plasmid #14789. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Hmga2 m7 mutant (see article and author's map for details) | 2026-08-15 01:07:07 | 2 |
|
pcDNA3.1 Hmga2 m2 Resource Report Resource Website |
RRID:Addgene_14790 | Hmga2 m2 | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen). Full sequence of wild-type plasmid available at Addgene plasmid #14789. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Hmga2 m2 mutant (see article and author's map for details) | 2026-08-15 01:07:07 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
