Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
gzk328-dpspCas13b_gRNA[ccdbCam]-10xPBSc_Loop
 
Resource Report
Resource Website 		RRID:Addgene_196844 Chloramphenicol and Spectinomycin PMID:37395412 Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint. Backbone Size:3308; Vector Backbone:PCR8; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Spectinomycin Addgene 2026-10-10 02:06:56 0
mCherry-FEN1
 
Resource Report
Resource Website 		RRID:Addgene_215129 FEN1 Homo sapiens Ampicillin PMID:38458201 Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:57 0
FFSS-Cyclin D1 (MV)
 
Resource Report
Resource Website 		RRID:Addgene_215089 CCND1 Homo sapiens Ampicillin PMID:38458201 Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Cyclin D1(MV) denotes mutations M56A and V60A. Addgene 2026-10-10 02:06:56 0
FFSS-Cyclin D1 (HP)-NeoR
 
Resource Report
Resource Website 		RRID:Addgene_215088 CCND1 Homo sapiens Ampicillin PMID:38458201 Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Cyclin D1(HP) denotes mutations M56A, V60A, and W63A. Addgene 2026-10-10 02:06:56 0
AcGFP-MSH2
 
Resource Report
Resource Website 		RRID:Addgene_215121 MSH2 Homo sapiens Ampicillin PMID:38458201 Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:57 0
AcGFP-MSH6
 
Resource Report
Resource Website 		RRID:Addgene_215123 MSH6 Homo sapiens Ampicillin PMID:38458201 Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:57 0
Fg vector
 
Resource Report
Resource Website 		RRID:Addgene_213464 Spectinomycin PMID:38409036 Backbone Marker:Hammond-Kosack' lab; Backbone Size:4497; Vector Backbone:Fg vector; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin Addgene 2026-10-10 02:06:56 0
EXO1B-AcGFP
 
Resource Report
Resource Website 		RRID:Addgene_215125 EXO1B Homo sapiens Ampicillin PMID:38458201 Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-N1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:57 0
Golgi-FAST
 
Resource Report
Resource Website 		RRID:Addgene_216341 ST6Gal1_pFAST pFASTderived from photoactive yellow protein (PYP) from H. Halophila Kanamycin used in HeLa cells Backbone Size:3870; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
Peroxisomes-FAST
 
Resource Report
Resource Website 		RRID:Addgene_216343 pFAST_SKL pFASTderived from photoactive yellow protein (PYP) from H. Halophila Kanamycin Backbone Size:3846; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
Golgi-FAST-IRES-iRFP670
 
Resource Report
Resource Website 		RRID:Addgene_216345 ST6Gal1_pFAST-IRES-Sys1_iRFP670 pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009 Kanamycin used in HeLa cells; SV40 promoter partial Backbone Size:3798; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
ER-FAST-IRES-iRFP670
 
Resource Report
Resource Website 		RRID:Addgene_216344 PRL_pFAST-IRES-CANX_iRFP670 pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009 Kanamycin Mutation 407F to L within Calnexin also works Backbone Size:3989; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
Peroxisomes-FAST-IRES-iRFP670
 
Resource Report
Resource Website 		RRID:Addgene_216347 pFAST_SKL-IRES-iRFP670_PXMP2 pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009 Kanamycin Backbone Size:3846; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
Mito-FAST-IRES-iRFP670
 
Resource Report
Resource Website 		RRID:Addgene_216346 Cox8_pFAST-IRES-Tomm20_iRFP670 pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009 Kanamycin SV40 promoter partial Backbone Size:3767; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin n/a Addgene 2026-10-10 02:06:56 0
53BP1 N-terminal sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_207091 GGGGAGCAGATGGACCCTAC Homo sapiens Ampicillin PMID:37341699 Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:56 0
pACRISPR-TP
 
Resource Report
Resource Website 		RRID:Addgene_203589 Trimethoprim PMID:38299816 Backbone Marker:This was built on the plasmid pACRISPR (addgene reference:#113348) from Quanjiang Ji; Vector Backbone:pACRISPR; Vector Types:Bacterial Expression; Bacterial Resistance:Trimethoprim Addgene 2026-10-10 02:06:56 0
pAAV.CAG.(mito).iATPSnFR2.A95A.A119L.miRFP670nano3
 
Resource Report
Resource Website 		RRID:Addgene_209723 (mito).iATPSnFR2.A95A.A119L.miRFP670nano3 Ampicillin PMID:38748581 Please visit https://www.biorxiv.org/content/10.1101/2023.08.24.554624v1 for bioRxiv preprint. Vector Backbone:pAAV.CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:56 0
PB-empty-DSE-TetO-8kb
 
Resource Report
Resource Website 		RRID:Addgene_213022 TetO Synthetic Ampicillin PMID:36471076 Backbone Size:2888; Vector Backbone:PB-empty; Vector Types:Mouse Targeting, Piggybase integration (Transposon); Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:56 0
PB-3xCTCF-TetO
 
Resource Report
Resource Website 		RRID:Addgene_213023 3xCTCF-TetO Synthetic Ampicillin PMID:36471076 Backbone Size:2888; Vector Backbone:PB-empty; Vector Types:Mouse Targeting, Piggybase integration (Transposon); Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:56 0
EGFP-Cyclin B1
 
Resource Report
Resource Website 		RRID:Addgene_215049 CCNB1 Homo sapiens Ampicillin PMID:38458201 Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:06:56 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch