Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:3308; Vector Backbone:PCR8; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:37395412
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.21.497089v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196844 Copy
Species: Homo sapiens
Genetic Insert: FEN1
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215129 Copy
Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215089 Copy
Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215088 Copy
Species: Homo sapiens
Genetic Insert: MSH2
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215121 Copy
Species: Homo sapiens
Genetic Insert: MSH6
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215123 Copy
Vector Backbone Description: Backbone Marker:Hammond-Kosack' lab; Backbone Size:4497; Vector Backbone:Fg vector; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38409036
Proper citation: RRID:Addgene_213464 Copy
Species: Homo sapiens
Genetic Insert: EXO1B
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-N1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215125 Copy
Species: pFASTderived from photoactive yellow protein (PYP) from H. Halophila
Genetic Insert: ST6Gal1_pFAST
Vector Backbone Description: Backbone Size:3870; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: used in HeLa cells
Proper citation: RRID:Addgene_216341 Copy
Species: pFASTderived from photoactive yellow protein (PYP) from H. Halophila
Genetic Insert: pFAST_SKL
Vector Backbone Description: Backbone Size:3846; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_216343 Copy
Species: pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009
Genetic Insert: ST6Gal1_pFAST-IRES-Sys1_iRFP670
Vector Backbone Description: Backbone Size:3798; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: used in HeLa cells; SV40 promoter partial
Proper citation: RRID:Addgene_216345 Copy
Species: pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009
Genetic Insert: PRL_pFAST-IRES-CANX_iRFP670
Vector Backbone Description: Backbone Size:3989; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Mutation 407F to L within Calnexin also works
Proper citation: RRID:Addgene_216344 Copy
Species: pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009
Genetic Insert: pFAST_SKL-IRES-iRFP670_PXMP2
Vector Backbone Description: Backbone Size:3846; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_216347 Copy
Species: pFAST derived from photoactive yellow protein (PYP) from H. Halophila; iRPF670 derived from Rhodopseudomonas palustris CGA009
Genetic Insert: Cox8_pFAST-IRES-Tomm20_iRFP670
Vector Backbone Description: Backbone Size:3767; Vector Backbone:Addgene #70113 ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: SV40 promoter partial
Proper citation: RRID:Addgene_216346 Copy
Species: Homo sapiens
Genetic Insert: GGGGAGCAGATGGACCCTAC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207091 Copy
Vector Backbone Description: Backbone Marker:This was built on the plasmid pACRISPR (addgene reference:#113348) from Quanjiang Ji; Vector Backbone:pACRISPR; Vector Types:Bacterial Expression; Bacterial Resistance:Trimethoprim
Defining Citation: PMID:38299816
Proper citation: RRID:Addgene_203589 Copy
Genetic Insert: (mito).iATPSnFR2.A95A.A119L.miRFP670nano3
Vector Backbone Description: Vector Backbone:pAAV.CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38748581
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.08.24.554624v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_209723 Copy
Species: Synthetic
Genetic Insert: TetO
Vector Backbone Description: Backbone Size:2888; Vector Backbone:PB-empty; Vector Types:Mouse Targeting, Piggybase integration (Transposon); Bacterial Resistance:Ampicillin
Defining Citation: PMID:36471076
Proper citation: RRID:Addgene_213022 Copy
Species: Synthetic
Genetic Insert: 3xCTCF-TetO
Vector Backbone Description: Backbone Size:2888; Vector Backbone:PB-empty; Vector Types:Mouse Targeting, Piggybase integration (Transposon); Bacterial Resistance:Ampicillin
Defining Citation: PMID:36471076
Proper citation: RRID:Addgene_213023 Copy
Species: Homo sapiens
Genetic Insert: CCNB1
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215049 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
